Veselé historky genetické, nejen pro Ptakopyska

Matzurka

Asi všichni tušíte, že nejsou všichni biologové stejní, dokonce ani genetici. Někteří se zabývají rostlinstvem (botanikové), jiní zvířenou (zoologové), a i genetici si volí objekty svého zkoumání dosti často podle svých oblíbených rostlin či zvířat. Jsou to pak takoví hybridi (tedy ti kříženci zoolog x genetik či botanik x genetik), kteří jsou dnes vesměs označováni buď jako genetici evoluční (je-li jím bližší genetika) nebo molekulární ekologové (přeci jen je víc baví běhat v terénu a nahánět své budoucí vzorky). No, a jelikož občas není snadné rozhodnout, o jaký ulovený druh se jedná (popisem druhových rozdílů se zabývají taxonomové, to už je další sorta vědců, schopných si zapamatovat množství nezáživných informací zvící telefonního seznamu Mexico City), vydumali ti genetičtí koumáci tzv. DNA barcoding, neboli čárový kód na základě kousku DNA. Představit si to je poměrně jednoduché, řetízek DNA tvoří jen 4 různé báze ve specifickém pořadí, pro jednoduchost si je lze znázornit třeba barevnými korálky na šňůrce, přičemž je tam navlékáme ve zdánlivě náhodném pořadí (ve skutečnosti to pořadí určuje strukturu bílkovin). Pokud bychom to pak z obou stran zducli, tak to vytvoří barevný čárový kód, obdobný tomu černobílému na zboží v každém superhyper. Důležité na tom koumání bylo zjistit, který kousek kterého genu bude zrovna tak proměnlivý, aby se na jeho základě dalo určit, že zkoumaný objekt je třeba ježek východní a ne západní.

Tento rozlišovací kousek DNA, dále mu říkejme standardně „marker“, byl objeven celkem nedávno, v podstatě na přelomu tisíciletí. Předcházela tomu řada studií, které používaly řadu jiných markerů, a když už jich bylo opravdu, ale opravdu hodně, si pár lidí sedlo na zadek a začalo to množství informací třídit, až se jim vyloupl ten dnes používaný DNA barcoding.

Jednou z těch předcházejících studií byla i práce doktorů zoologie/genetiky Bakera a Palumbiho, kteří ve své době měli za cíl najít markery pro velryby. Jak je dobře známo, velryby jsou loveny a pojídány, ovšem je jich čím dál tím méně a mnohým druhům začíná hrozit vyhynutí (vlastně sežrání hladovým druhem Homo sapiens). Mezinárodní velrybářská komise proto požádala oba výše uvedené vědce, aby jim trochu pomohli, neb komisi se přeci jen zdály některé balíčky s masem na asijských trzích podezřelé. Oba kolegové projevili dobrodružného ducha, neboť aby neporušili zákon o zákazu vývozu masa z ohrožených druhů, odcestovali do Japonska s velkým kufrem, v němž bylo zapůjčené „cestovní“ laboratorní vybavení (firma věděla, jak se dělá marketing), a v hotelovém pokoji si udělali provizorní laboratoř. Pak se vypravili na nákupy, a donesli si celou škálu produktů označených „velryba“ od masa sušeného, soleného, marinovaného v sezamovém oleji či sójové omáčce, až po čerstvé řízky. Z tohoto materiálu extrahovali DNA, a pak připravili onen „marker“. Ten už se vyvážet může, takže přesnou sekvenci, tedy pořadí oněch barevných korálků, určily laboratoře na Novém Zélandu a v USA. Nooooo… konec si jistě domyslíte, ze 16ti vzorků jich bylo 5 z chráněných druhů, a další tři pocházely z delfínů a mořské želvy (což se sice asi lovit může, ale klamání zakazníků se přece nedělá). O něco později byla provedena podobná studie ve větším rozsahu, ta už zahrnovala i nákupy z Koreje, a z celkového počtu 954 vzorků jích bylo 773 opravdu z velryb (z toho zhruba 9% z chráněných druhů), zbytek opět z delfínů, želv, ale i ovcí a koňů. Ňam !

DNA Barcoding se tímto a dalšími případy stával stále více populárním, takže dnes existuje obrovská porovnávací databáze, používaná pro ledacos. Ovšem u zrodu tohoto projektu stál pro změnu zoolog/genetik kanadský, dr. Hebert. I jemu se podařil hezký kousek….

V r. 2007 si jedna paní v Chicagu koupila na asijském tržišti dvě mražené ryby („ďas mořský”), a uvařila z nich rodince dobrou polívčičku (příprava zahrnovala očištění, vykuchání a 7 hodin máčení ve studené vodě). Paní si dala pořádný nášup, manžel i dcerka si dali pár misek (dcerka spíš jen mističku), načež se rodičům udělalo velmi nedobře. Paní zvracející, s otupělostí a brněním v okolí úst, celkovou slabostí a bolestí na hrudníku přijali do nemocnice, manžel měl naštěstí příznaky slabší, takže byl ponechán v domácí léčbě, dcera byla bez příznaků. I začalo horečnaté hledání zdroje nemoci, takže byly zbytky kůže a vnitřnosti podrobeny chemické analýze; vyšetřování se zaměřovalo na tetrodotoxin, obávaný nervový jed. Samozřejmě že se do toho vložil federální zemědělský úřad, který má mimo jiné v popisu práce také dohlížet na kvalitu dovážených potravin. I strhla se mela převeliká, prací téměř detektivní byl zjištěn prodavač i další ochody, které obdržely stejnou či obdobnou zásilku s nevinným označením „ďas mořský, vykuchaný a bez hlav, vyprodukováno v Číně“. Kromě chemiků ty zmraženiny posuzovali i zoologové taxonomičtí, ale došlo i na dr. Heberta. Jemu byly zaslány rozvařené zbytky masa z oné polévky…. a mělo to dobrý konec, neboť i on na základě genetického markeru potvrdil podezření ostatních zúčastněných, že šlo o jedovaté čtverzubce, v Japonsku známé jako poněkud adrenalinová mlsota „fugu“. Paní se uzdravila po třech týdnech, manžel mnohem dříve, a dr. Hebert dnes stojí v čele nadnárodního konsorcia pro DNA Barcoding s cílem přidělit kódy všemu živému, co na této planetě pobíhá. Databáze je dnes obrovská, ale ukazuje se, že platí jen na živočichy, a ještě ne všechny. Ale nebojte se, pracuje se i na markerech pro další organismy, takže ve tmě tápat nebudeme.

A teď hezky do postýlek…. vlastně ne, pokud byste měli zájem nebo vás trápil nějaký prťavý živočich, kterého lze odchytit a v lihu zaslat k analýze, můžete se mi ozvat – tuhle identifikaci děláme s mými studenty v rámci výuky, a mnohdy je to rychlejší, než se dopídit specialisty taxonoma na tu či onu zvířecí skupinu (neboť na rozdíl od něho genetici neběhají v terénu mimo dosah signálu).

 

PS.

Oba uvedené případy jsou zdokumentované v odborných publikacích, pdf v AJ je volně k získání a mohu přeposlat.

Příspěvek byl publikován v rubrice Nezařazené a jeho autorem je Šumavák. Můžete si jeho odkaz uložit mezi své oblíbené záložky nebo ho sdílet s přáteli.

838 komentářů u “Veselé historky genetické, nejen pro Ptakopyska

  1. 🙂 “ genetici neběhají v terénu mimo dosah signálu“ na „Vomáčce“ u Zlivi… 😀

  2. Vomáčka je povinné terénní cvičení pro prváky – takto biologický potěr – hned na začátku prvního semestru prvního ročníku. Takže mnozí z nich ani neví, co z nich na konci třeťáku bude 🙂 Ale i budoucí genetici si ten seznamovací týden užijí s radostí; pravda, je to opravdu věc taxonomicko-ekologická, žádnou přenosnou laboratoř na DNA analýzy sebou nemají (a genetika mezi pedagogy neuvidíte – i kdyby chtěli, tak leda soukromě jako dovozce buřtů, oni si to ti botanici/zoologové žárlivě střeží). My pak studenty lákáme do laborek po návratu 🙂

  3. Matzurko, díkes – si myslím, že udělat DNA Barcoding něterých masových balíčků třeba v Tescu by též mohlo být nadmíru „zajímavé“ …:)

    Dvě pozitivní zprávy:
    Ten bílej hnus konečně přestal padat. Před domem mám jakousi bílou kouli jak od sněhuláka. Jelikož to má červenej podolek a stojí to u mého domu, mohu soudit, že se jedná o moje auto. Až to půjdu očistit, patrně způsobím lavinu.

    Druhá zpráva je, že je pátek, zítra skončí volby a konečně bude pokoj – co je moc, to je zu moc!

  4. To s tím sněhem je nějaký fejk, že jo ? Tady ani ťuk. Celé tři dny.

  5. NoName – to je tedy nespravedlnost! Tady napadlo dobrého půl metru!
    Ale můžete si přijet a dám vám kolik budete chtít! 🙂

  6. Matzurko,
    díky. Jak by řekl commandant Eric Lassard: „It is very very very very well said.“

  7. 3 Dobrý den, Rputi není to až za týden?
    Heslo „Landsmanschaft volí Karla“ je v naší krajině takové pěkně rezonující. Někoho to potěší, ty, kteří v posledních 65 letech nabyli nemovitý majetek, to potěší méně.

    Kdyby se byl býval držel pan kandidát česko-německé deklarace, mohl by mít více hlasů a vypadal by moudře.
    http://cs.wikipedia.org/wiki/%C4%8Cesko-n%C4%9Bmeck%C3%A1_deklarace

    Tuto část duelu jsem neviděl, prý si toto téma zvolil pan Zeman.

  8. je to za týden = volby
    a to zu je stejné jako to z se sedmým pádem 🙁

  9. je to za týden = volby
    a to zu je stejné jako to z se sedmým pádem 🙁

  10. Matzurko, děkuji za poučení. Vy jezdíte do Zlivi? Koupete se v Mydláku a potom pozorujete genetické změny populace a vývoj druhů? 😉

  11. Dobré ráno,

    taky mám dojem, že volba bude až za týden.
    Ale nebojte se, rputi, určitě se potom najdou nějaký další volby, aby se nemuselo přestat blbnout.

    V Praze přibylo cca 10 centimetrů čerstvého sněhu. Na chodníku to nenamrzá, ale ta vlhká břečka na mokré dlažbě není o nic lepší.
    Budu muset babičku ukecat, že odpoledne jí někdo zajde nakoupit, aby nelezla na ulici, jinak se přerazí. Soběstačnost je fajn, ale vocaď pocaď.

    Jinak dcera včera kńučela, že se asi nesejde dramatický kroužek, protože se poměrně velký podíl členů omluvil, neb popadali s chřipkou.

  12. Divano, píšete za oba kandidáty, že ? 😉
    Včera jsem slyšel rozhovor V. Klause ml. a Veselovského na ČRo1. V. Klaus ml. byl v lehké defenzivě, ale může si za to sám-argumentoval dost nekonzistentně, a pak nebylo úniku.

  13. nickname, děkuji! Tady vidíte, jak už z toho jedna blbne – já mám dojem, že už to trvá strašně dlouho … 😀

    divano – nikoliv! „ZU MOC“ je napůl z němčiny přeložené „ZU VIEL“ – tedy „PŘÍLIŠ MNOHO“! S českým Z/S to nemá vůbec nic společného!
    Dohromady tedy „To je příliš mnoho.“ KDE tam, propánajána, máte 7. pád? 😀

  14. Někde sněží, tady pro změnu mrzne – za okny bylo ráno mínus 8, doteď to stouplo na mínus 6. Nesněží.Nemusíme mít furt všecko. :-)))
    Matzurko dík. Pro mne je tahle oblast vesnicí ve Španělích.

  15. Rputi,
    asi jsem to nečitelně popsala
    rozpitvám
    zu (z němčiny) viz = to je zu moc mi přijde stejně slabé jako
    z místo s v 7.pádu viz = z člověkem
    bohužel dost mých kamarádů žijících v německu to zu používá až je podezřívám, že schválně a mně to rve uši
    i tady se to pomalu prosazuje v pár exemplářích 🙂

  16. NIckname,
    kdepak já a Zliv, ani parcelu ku stavbě domečku jsme tam nekoupili, i když jí dávali levně, levně…. se zajímavým výhledem 🙂 Univerzitní statek „U Vomáčků“ je snad ale kousek dál.

    Jo, jednou jsem do terénu vyjela, kolegové mně nalákali na Šumavu. Lilo celou cestu tam i zpátky, a to tak, že ani ti ostřílení zoologové z auta nevystrčili než frňák, aby vzápětí s temnými kletbami tento zastrčili a otočili volantem. Inu, každý svého štěstí strojvůdcem, přeci jen, v laborce je aspoň sucho.

    Swetr report – Budějice jsou dneska jak umrzlé oraniště, i když pluhy pluží, na vozovce jsou zmrzlé hroudy a kry, mezi nimi rozježděný sníh, všude okolo duny nahrnutého sněhu (i uprostřed křižovatek, neb to už asi nebylo kam jinam shrnout). A to jsou hlavní cesty, všude jinde je prostě sníh na sněhu, u Výstaviště kolem odstavného kamionového parkoviště to vypadá, že kdo zajel, vyjede až s jarním táním.
    MHD opět sporadické.

    Ptakopysku, děkuji 🙂

  17. divano – „zu moc“ říkala už moje babička, to je prostě pozůstatek germanismů v češtině. 🙂

  18. hmm, moje babička němka to nepoužívala 🙂
    asi proto mi to rve uši

  19. divano, to jsou ty rodinné zvyklosti.
    Naše Tante Juli zas říkala „ten husíček“, což nejen, že nám nervalo uši, ale navodilo Pavlovův reflex, neboť její „TEN HUSÍČEK“ byl teda NĚJAKEJ husíček, takže jsme se olizovali už týden dopředu. 🙂

  20. Moje babička taky říkala „zu moc“. S německou výslovností „cu moc“

  21. 19 U Zlivi je krásně. MAPE napájí kaskády rybníků. Kapry z těchto rybníků poznáte v Praze u Tesca tak, že jim svítí očička 🙂
    Vždycky jsem se divil, jak to, že u babičky je větší zima než u nás na severozápadě.

  22. doufám, že to není důvod ke sporu – obojí je správné. České babičky používaly „zu moc“, u té mojí jsem to nepozoroval, ale můj otec to někdy vyslovil. Německá babička nemohla používat zu moc, pokud byla Němka. Neznala germanismy, ona sama mluvila „germánský“.

    To je pěkné, když mají všichni a všechny pravdu. Dopoledne uplývá, plotna ještě nežhne, kafíčko je vypito a za oknem bílo.

  23. nickname – 25 – přece teplý Golfský proud je blíž.

  24. Nickname,
    před tou Zliví nás kolekové „vocuď“ důrazně varovali… a když kupuji kapra na vánoce, dobře koukám, odkuď ti kapři jsou.
    Až budete mít cestu naším krajem (máte tu ještě příbuzenstvo ?) – ráda pokecám „z voka do voka“. Bydlíme sice kousek jižněji, zato je od nás blíže na Kleť, a samozřejmě ráda předvedu svou skromnou laboratoř – svých daňových poplatníků si vážím 🙂

    Jo, a doufám, že doma dobrý, a Mojžíšek nezpůsobuje adrenalinové stavy 🙂

  25. 29 Do kraje mého mládí se rád někdy podívám, ale naposledy jsem tam byl dědovi na pohřbu. V roce 2000. Spíš teta – ornitoložka a turistka nás tu navštěvuje, tak jednou za pět let.
    Mojžíška ještě nezlobí, zítra máme termín.

  26. Matzurko, hluboká poklona a díky za článek.

  27. no, tak u nás v noci jen tak mírně sněžilo; počasí pošmourné, zachmuřené ,všeobecně nesympatické 🙁 Cesta do H.B.( se psem na stříhání- byl už obrostlý jak Ezau) v kolonách kvůli pluhům a sypačům 🙁
    Nevím, kde berete sílu koukat se ještě na média ; jen jsem se ráno jukla, a tlak mně stoupl do výšin lékařskou vědou neznámých 🙁 Raději budu počítat mrtvoly v nějaké obzvlášť krvavé detektivce ( např. Krvavý sen) 😕

  28. Matzurko, prima a povedené povídání 🙂 Já jsem taky kříženec, prosím – ekofyziolog x botanik, ale i když se v terénu tím pádem taky vyskytuju, nemusím budoucí vzorky nahánět – zapouštějí ovšem občas kořeny na místech krajně krkolomných, kam se za nimi škrábu, čvachtám a brodím (občas padám…) Vzhledem ke specializaci (a protože jsem z lékárnické rodiny) by mě docela zajímala identifikace složek některých zvláště podezřelých bylinných čajů… taky by se jeden možná divil.

    Jihozápadně od Prahy asi 15 cm nového sněhu a už nepadá. Celkem to jde.

  29. Zdravím, a taky chválím. Pěkný článek, Matzurko, pište víc! ;-))

  30. Konečně osvěžující nepolitické téma, výživné a srozumitelné pro nás laiky. Byl by to tak akorát článek do Vesmíru. Nebo pro Meteor. Těším se na pokračování. Moc líbí. Rád bych věděl k čemu slouží „prázdné“ úseky DNA, prý zbytečné. Jenže příroda nedělá moc zbytečného a jestliže nevíme jak se tam vzaly a jakou mají funkci, je nerozumné tvrdit, že nemají žádnou funkci, že jsou zbytečné a že je můžeme vystřihnout a zahodit.
    Využití vidím nejen při kontrole co mám na talíři, ale v medicíně. Výtěr z krku nebo jiný vzorek, žádná kultivace a rovnou výsledky že takové breberky.

    Možná v budoucnu bude běžně k dostání levný analyzér. Píchnu do paštiky a na displeji přečtu výsledek 0,001% skřivan, 99,999% kůň.

  31. >> varan
    Ony ty čaje mohou být vskutku překvapením. Okolo roku 90 se v Evropě (a pokud vím, tak v ČR rovněž) objevil léčivý čaj čínské provenience, působící proti atakům rheumatismu. Vzhledem k tomu, že rheumatismus je jaksi „multidisciplinární“ bylo zajímavé, že čaj působí bez ohledu na tu „disciplinu“. Analýza ukázala, že jde o drcené luční seno s přídavkem dosti nebezpečného protizánětlivého preparátu na steroidní bázi plus ještě další chemické svinstvo u něhož si na detaily nepamatuji. Akorát bojovníci za přírodní léčbu vykřikovali cosi o spiknutí oficiální mediciny.

  32. 35 ohledně bylinných čajů
    jsem si vzpoměla, že kousek od plzně byla jedna kořenářka
    a občas vypadala jako sjetá
    ono nejen ty houbičky umí nadělat paseku
    🙂

  33. Já se snad na ten presidentský duel snad přece jen podívám. Jednak mám, dle článků různých autorů pocit, že se těch duelů odehrálo několik a dvojak, jestli Matějka má pravdu a Moravec dostal od Zemana na zadek, tak to shlédnu z obzvláštním potěšením! 🙂

    Václav Moravec dostal konečně výprask. Od Miloše Zemana
    http://frantisekmatejka.blog.idnes.cz/c/316751/Vaclav-Moravec-dostal-konecne-vyprask-Od-Milose-Zemana.html

    BOHUMIL PEČINKA: Zeman v duelu přejel Schwarzenberga
    http://www.reflex.cz/clanek/jine-volba-prezidenta-2013/49214/bohumil-pecinka-zeman-v-duelu-prejel-schwarzenberga.html

    Politologové: Debata kandidátů neměla výherce
    http://www.novinky.cz/domaci/290607-politologove-debata-kandidatu-nemela-vyherce.html

  34. Schumi,
    „prázdné úseky“ jsou tam proto, aby si příroda mohla občas oddychnout při realizaci těch neprázdných… 😉

  35. Sníh….bratranec každodenní automobilista má třístupňovou stupnici :
    0-5cm : bílý svinstvo
    5-10cm : zkurvený bílý svinstvo
    10 a více cm : zasraný zkurvený bílý svinstvo.

    Já tomu říkám zimní pohádka.

  36. Otázka:
    Kolik procent telecího masa musí v Německu obsahovat telecí párek?

  37. Ještě k bylinkám, no právě, dvd – je to ode mne možná trochu paranoia, ale mám sklon věřit jen těm jedům, které bych si eventuelně namíchala sama. Existuje obor zvaný farmakognosie, který umožňuje posoudit složení takových směsí, ale mám dojem, že s průmyslovým zpracováním (kde jsou ty časy, když v lékárně bývaly obrovské skříně plné šuplíčků s bylinkami a lékárník míchal…) i farmakognosie ztratila poněkud na významu. Tak třeba by ta DNA…

  38. Masti a kapky se dělají pořád ještě v dost velkém měřítku. Aspoň tedy někde…
    Je to záležost vyloženě ztrátová, ale někteří lékárníci se tím baví (o jedné vím určitě 😉 ), varanko …

  39. 39 divano, z léčiv i z bylin je běžně dostupné lecos z čeho by se někteří puritánští prohibicionisti potento. Dají se namíchat lecjaké lektvary. Jenže jak jsem pohodlnej, uvítal bych osvěžovnu jako „U Jindry Nalejváka“, scifi znalí vědí o co jde.

  40. Matzurko, pokud ti dva důvtipní pánové v Japonsku objevili DNA želvy (předpokládám, že to byla kareta), tak to je podle IUCN kriticky ohrožený druh a lovit se nesmí, některé druhy delfínů jsou na tom podobně. Jenže ona ochrana živočichů zvláště v Asii je hodně tvrdý oříšek – jednak tamní národové jsou schopni konzumovat naprosto neuvěřitelné věci neuvěřitelným způsobem, jedna někde opravdu je trochu nouze o proteiny (Japonci), a to se stejným výsledkem: snědí na co přijdou. A to nepočítám různé legendy o afrodiziakálních, posilujících, léčivých a nesmrtelnost zaručujících preparátech, z jejichž složení taky občas vstávají vlasy na hlavě.

  41. To je pravda, no name – moji mamku to taky hrozně bavilo (receptář máme samozřejmě doma pečlivě schovaný, je to pamětihodnost 🙂 ), ale já už se bavím jen tím, že čas od času nějakou dobrou duši magisterskou uvedu do rozpaků přáním získat solutio Jariš (piš jak slyšíš). Mám jinou odbornost a řetěz lékárnický třímá můj mladší brácha.

  42. Schumi, a půl metru čerstvého prašanu, na místech kde nejsou závěje (Tam kde jsou,je i podstatně více), označuje jak?
    Já jako bílý sračkovitý průser!
    Seno sice mám ale v takové závěji, že mi ještě pořád není jasné, jak se k němu dostanu, natož jak ho dostanu dovnitř a dolů do výběhu…, ale je mi jasné, že to musí být nejpozději zítra… 🙁 🙁

  43. ad 40,
    dottore nemůže reagovat, neboť právě podává vysvětlení 😀

  44. Sněhové hlášení z oblasti jihozápadně od Prahy: asi 20 čísel úplně nového prašanu (přes noc). Když jsem ráno vystrčila nos se snídaní pro pravidelné kočičí bezdomovce, začalo se na zavolání blížit ke dveřím několik různě barevných ocasů, na jejichž konci kdesi dole pod sněhem bylo možno tušiti kočku. A s balíkem sena pro své dva koně měl problémy i soused vedle nás… pravda, Šumaváku, na tebe nemáme. Díkybohu.

  45. varane, a co kalium iodatum?
    nejodpornější lékárnický produkt, který znám.

  46. dvd 54 – právník si nemyslí nic. Novinář z něčeho čerpal a určit+ to blbě napsal. Abych k tomu něco mohl napsat, musel bych vědět data, znění listin atd. ženské prohrály soud a byly odsouzeny k náhradě právní pomoci druhé strany. To nezaplatily ve lhůtě stanovené v rozsudku. Pak zaplatily, ale kdy a jak dlouho před podáním návrhu na exekuci, to nevím. Taky nevím, jestli zaplatily včas jen dluh a už ne advokátovi protistrany.

    Ten dal návrh na výkon rozhodnutí. Kdy? Jak dlouho to leželo u soudu než to podal exekutorovi? Exekutor na základě podkladů vydal exekuční příkaz a ženské mohly klidně prokázat exekutorovi, že to zaplatily už před podáním návrhu. To asi neudělaly. Celý článek je tak do nedělní přílohy Novinek, když se do napsání stačily ještě ty ženské obrátit se stížností na Advokátní komoru, tak to projednala a jako neopodstatněnou stížnost zamítla. Tak asi Komora shledala, že se advokát ničeho nedopustil. Naše Komora se s námi moc nemaže.

    Takže Plačky naší Kačky v Novinkách.

  47. maYdo, co máš proti jodidu draselnému? Dává se do lecčehos, desinfekcí počínaje a nouzovou náhražkou při potížích se štítnou žlázou konče, no – přiznám se, že jeho chuť si nevybavím, ale soudě podle složení nic moc to asi nebude 🙂

  48. varanko, k tomu dotazu z minula. Novinářský zmatek – polehčující okolnost? Při narovnání musí být splněny podmínky, jedna z nich je souhlas poškozeného s narovnáním. Když souhlasí, tak to není žádná polehčující okolnost. Není k čemu. Je-li schváleno narovnání, tak je to prostě skončené. Součástí narovnání je ale povinné doznání pachatele, že se skutek stal tak, jak je mu kladeno zavinu. Takže Janoušek by musel před soudem prohlásit, že se to skutečně seběhlo tak, jak říkají účastníci.

    Nic o tom nevíme, novinář taky ne a někdo mu něco řekl, on to blbě pochopil a ještě blběji napsal.

    Zajímavé na celé věci je jen to, jak se nikdo při kritice amnestie nezajímá o to, že máme tolik zavřených za činy, které se v cizině řeší jinak než nepodmíněným trestem – třeba zrovna narovnáním. Ale to je jiná pohádka.

  49. Maydo, za mého mládí se říkalo – Nemáš-li co dáti, dej kalii jodati.

  50. martineTT,
    tuneláře je třeba exemplárně trestat, děj se co děj! Obzvláště jsou-li majiteli audi prohibiti 😛

  51. Bylinky já ráda, jen si ty dryáky raděj míchám sama a hlavně o tom nemluvím s felčarama. Oni snad proti tomu něco mají, či čo? 🙂

  52. Jistě, Martine TT, já jsem to taky brala s obrovskou rezervou. Jednak to byla novinářská interpretace (podezřelé a priori), jednak se opravdu nemíním plést právníkům do řemesla a už vůbec ne, když o celé věci nic nevím. Obávám se, že při kritice amnestie ( a jiných případů) se nikdo ani nemá chuť zabývat tím, co skutečně za zájem stojí – třeba to, co jsi napsal o množství nepodmíněných trestů u nás nebo důvody těch neskutečně dlouhých soudních sporů (IMHO ne vždycky za to mohou rafinované obstrukce obhajoby). V politickém kotli se z toho podařilo uvařit bojovný eintopf zvaný „chyť jak můžeš“, jen to právo a spravedlnost – já vím, že to není totéž – se nám z toho kotle jaksi vypařily.

  53. 54 dvd, to je v našich poměrech problém. Například žalobou domáhající se neexistujícího nároku nelze spáchat tretsný čin. Třebaže by byla sebenesmyslnější. Je na to judikatura. Stejné je to i v případě návrhu na exekuci. Já s tím nesouhlasím, dovedu si představit případy s flagrantním úmyslem, že bych v tom viděl tretsný čin. Jenže je nutné prokázat subjektivní stránku spočívající v úmyslu pachatele. Potíž je v tom, že ten kdo je pověřen vymáháním dluhu, nemusí být zpraven věřitelem, že pohledávka je uhrazena. Dokonce tak může dojít i k tomu, že přesto, že je uhrazena, může být postoupena a vymáhána v exekuci. Chybička se vloudila, ale úmysl? Velmi obtížné až nemožné prokázat úmysl. Jsem toho názoru, že právní řád by měl být nastaven tak aby takovým případům bylo zabráněno, stejně i desetitisícovým exekucím pro zanedbatelné dluhy. Ke každé soudně vymáhané pohledávce nechť existuje v elektronické podobě její historie a sankční odpovědnost věřitele bezodkladně oznámit její uhrazení. Bez ohledu na to, není přakážka bránící aby soudy by v civilním řízení promptně vyhovovaly žalobám na majetkovou i nemajetkovou újmu způsobenou domělému dlužníku šikanosním vymáháním již zaplacených pohledávek.

    Každému by měl být snadno přístupný centrální registr dlužníků. Možnost soudního vymáhání pohledávky by byla podmíněna její registrací. Každý kdo by měl zájem sledovat zda je dlužníkem, měl by bezplatnou možnost se zaregistrovat. Snadno, tak jako se například připojuje ke svému mailovému účtu by kdykoli včas zjistil, jestli má nějakou neuhrazenou pohledávku.

  54. Pratele, i Vidni se problemy se snehovou nadilkou nevyhnuly. Je ve dvanactem okrese ulice(Schwenkgasse) ktera vede rovne z kopce(samozrejme pro ty co jedou v protismeru je do kopce, pro stouraly mezfi vami) a je tradici ze v pripade ze napadne vic nez deset centimetru snehu ulice se uzavre, autobus a auta se odkloni a z cele ulice je sankarska draha k nesmirne radosti deti, dedecku a babicek. Je slyset prevazne turecky jazyk, ale radost maji vsichni. No a predstavte si ze letos jim to nejakej sypaci vuz posypal !!!! ,nez to stacili zavrit! Ted se resi kdo. Ho tam poslal, a ozyvaji se hlasy ze to byl nejspis nejaky auslender, ktery nema rad bud snih, nedo dokonce rakusany…..pro radiozurnal Marie Woodhemsova – Viden

  55. návštěvu v Matzurčině laborce vřele doporučuji, byla to zábava i poučení. Nádavkem kniha o pramátích pro domácí studium. A vrchol všeho- už vím, která byla moje pramáti(klasicky průměr,žádná exotika:)

  56. 64- ono to uzavírání ulic pro MHD a auta za účelem zábavy Vídeňanů je zřejmě obvyklý šprým pro turisty- když si vzpomenu, jak jsem po celodenní honičce po památkách štrádovala další tři kiláky do hotelu, páč na ulicích se popíjelo pivo a hrál jazz…

  57. tak Turci přece jenom dobyli Vídeň… a ještě to vídeňákům někdo pořádně osolil…
    jsou to radosti 🙁

  58. Napsal bych vam jak jsou po vcerejsi snehove nadilce uklizeny ulice a chodniky, ale napsal jsem to loni na jinem blogu, a pes by si odemne kurku nevzal 😉
    Opomel jsem totiz ze my mame Vysocinu!!! (ne ten salam!) Tak toho radsi necham . . 😉

  59. 58 Martine, také si nemyslím, že v tom byl úmysl, žádný advokát si nebude komplikovat práci kvůli pár pětkám. Jenže znám případ, že takhle šlo o barák. Půjčka zajištěná zástavním právem a ještě směnkou. Když dlužník přišel včas s penězi zaplatit, věřitel se mu vysmál, ať si je nechá, on že si nechá barák. Krom toho tam bylo „pro pořádek“ ručení směnkou, tu věřitel postoupil ještě před splatností dluhu a ta část pohledávky žila vlastním životem. Myslel si, že věřitel nebude moci splatit dluh. Zabývala se tím policie. Pravda, šlo o divoká léta devadesátá. Co se týče novinářských a nejen novinářských pohádek, za léta jsem vyslechl lecos. A zajímavé, většinou nakonec vylezlo něco s čím se dlužník hned nechlubil.

  60. Andy,
    třeba je to nervozitou. Možná má pocit, že se mu v obuvi dochází k hromadění dihydrogenmonooxidu v kapalné formě. Taťka stříhá metr a buchvíjak to bude se sponzorama. Já bych byl nervózní, jak těhotná sýkorka…

  61. Andy, já mám vůbec dojem, že Schwarzenberg svým postupem do druhé rundy spoustě lidí zvedl mandle (a jestli slyšíte něco šustit, tak to škodolibě mnu ruce :-)) Na pročítání všech možných plků nemám náladu ani volnou kapacitu, ale jak tak namátkou vidím titulky, tak se z 90% navážejí do ministra zahraničí a nikoliv do Zemana. A podpásovky se ještě budou množit, to je podle všeho místní folklór 🙁

  62. 72- nevím, koho kdo chce strašit starýma nacistama. Jsem z generace, která měla rodiče pamětníky války a byla krmena odmalička nenávistí k Němcům, ale i já už jsem, co se týče starých nácků naprosto klidná a dívám se na spoustu věcí poučenějšíma očima. Můj syn už takové informace bere podobně jako já vpád Švédů do Prahy a rozhodně pro něj tohle není rozhodující, když si vybírá prézu.

    VK mladší začíná být fest trapnej.

  63. 68 Andy, kouknul, přečetl a jen jsem si zamručel, že mi to cosi připomíná. Odpovědnost za nevhodný původ. Třídní, židovský… Jít na první rande s kádrovým dotazníkem….
    V té souvislosti mě napadá mnoho velmi nepěkných výrazů a přirovnání. Dal jsem si závazek že se vynasnažím vyhýbat se vulgaritám jak jen to vydržím. Však lomcuje to se mnou velmi. Jak jadrně by mu odpověděl MiloŠ Zeman byl-li by takto osočen… Velmi oceňuji Schwarzenbergovu zdrženlivost. Snažím se v tomhle z něho vzít si příklad. I když ho nevolím.

  64. Já jsem včera ten rozhovor slyšel, jak už jsem psal-Klaus ml. nezačal dobře a Veselovský neměl problém ho v tom vymáchat. Klaus ml. si protiřečil a byl argumentačně dost plytký, ale přitom útočný-Klaus starší si to může dovolit, protože má argumentaci daleko lépe propracovanou, ale tady působila ta útočnost rušivě.

  65. Andy, naši válku taky pamatovali, byť u mamky se ta vzpomínka koncentrovala především do pocitu křivdy, když musela jejich škola vyklidit krásnou moderní budovu pro nácky (Drtinovo gymnázium na Smíchově). Mě už „staří náckové“ taky neberou a pro další generaci to je stejný dějepis jako vpád Pasovských. Stejně jako Schumacher oceňuji Schwarzenbergovu zdrženlivost, bude jí asi potřebovat ještě hodně… Já už bych na jeho místě používala výrazy, o nichž dosud netuším, že je vůbec znám – a pak by mě to nepochybně mrzelo.
    MMCH – ta tabulka „populárních osobností“ je hodně vypovídající…

  66. On Schw. si zase mohl odpustit hlášku, že jsme se na Němcích dopustili křivdy. To nadzdvihne leckoho i když už je mu to jinak šumák…

  67. Je snad rozdíl tahat do kampaně rodiče manželky( což je opravdu, ale opravdu podpásovka, nevím, kdo se žení či vdává až po prokádrování famílie do pátého kolena) či keců o tom, že by préza měl prožít život v zemi, kde chce prézovat( jako to udělal Zeman, který fakt nemusel utíkat z ČR kvůli bolševikům) a rozdíl vyjádřit svůj názor na cokoli.

  68. berte v úvahu rozhled a city průměrného českého voliče – včera a dnes jsem na několika místech zaslechl rozhořčenou debatu na téma neznalosti češtiny paní manželky. Budou volit Zemana, protože ta baba neumí česky. A je to!

  69. Zvláštní, že na Becherovku nebo Teslu Blatnou si lidi nevzpomenou…

  70. 81-no, já k prvnímu kolu voleb nešla, nechala jsem všeholid, ať prokydá tu změť, tentokrát půjdu a protože jsem dodnes aktivní odpůrce opoziční smlouvy a pamatuji si kufříky, Grosse a Buzkovou, nemluvě o tisíci dalších věcí, kdo bude guvernér ČNB je podle mne sice důležité, ale ne zásadní( i když Švejnar mne bude zřejmě děsit ve snech do smrt, je to šedý mor) a Zemanovský příklon k ruskému medvědu nepřekousnu, tak to asi nafasuje Schwarzenberg, ať už jeho tchán byl nácek nebo partyzán.

  71. Ale stejně mi připadá blbý , že jde kníže proti jednomu ze svých nejlepších zákazníků !
    To se neděá ! 😀

  72. Vite, ono je to tezke…..
    Za prve dekuji Mazurko, dekuji za clanek, ulozil ksem si ho a otevrel kalendar, abych mohl naplanovat cestu do Budejic. Vezmu se bou nejstarsi decka, at videj, jak ziji nekteri z nas a ze je dobre neco umet a vedet. Ja sam jim to poskytnout samozrejmemnemohu, ale kdyz je takovahle moznost, sem s ni ….

    Musim rici, ze by melo byt specifikovano, ktere benesove dekrety se budou rusit. Vzdyt od 45 jich bylo docela dost a mnohe se nasi rodiny dotkly, co se tyka majetku. Takze kdyby se zrusili, tak bych ….. No proste by se dely vec. Jinak tento zpusob kampane povazuji za extremne nechutny a vcera jsem si dovolil koukat na debatu s prezidentama a musim rici, ze Zeman byl velmi nechutny, moravec samozrejme take, ale blabolilovi z Vysociny nesahal ani po paty

  73. Andy, uvedom si , ze pokrokovej svet voli Zemana… Dyt to je kamarad Klause a tak je to hodnej kluk… Tedy az ted, protoze driv to byla bestyje dstici siru a ohen…..

  74. 87- tím spíš ho nemůžu volit- čtu starý knížky, mám starej nábytek, starý obrazy, sama jsem stará, vyznávám staré hodnoty- kdepak na mne s pokrokem.

  75. 88 když jsme u těch nápadů, podíval ses na ten flash? Synek za něj dostal pochvalu před nastoupeným kruhem a zápočet.

  76. 78 Rputi vždyť to je také důvod proč ne. Dnešní měřítka nelze brát na včerejšek. Dobře ví, že to bylo posvěceno rozhodnutím vítězných velmocí. Po šesti letech vraždění. Asi jsem podjatý, když jsem se dověděl že jeden můj ne až tak dávný předek vyletěl komínem. Pohnutá rodinná historie, kterou jsem dlouho neznal. Některé věci se dětem neříkají, a pak je pozdě. Nenašel jsem včas cestu. Vždycky si na něj vzpomenu když si kupuju Pribiňák. Protože tuhle výrobu a lecos jiného tam….
    I když…když vidím co jak i po těch mnoha desítiletích vypadá pohraničí a jak tento národ nakládá s územím které si nárokoval. A jak zachází sám se sebou. Hlavou mi táhnou lecjaké nepěkné myšlenky kdo všechno měl pravdu stran zdejšího lidu…

  77. Andy, videl jsem to rano a ten s tema slovama je uchvatny….. Mohu si ho prosim „ukrast“ ne tedy napad, to nikoliv, ale pouzit ho a napsat i ze autor nejsem ja, ale ze mohu zprostredokovat kontakt pro zajemce?
    Jinak ten napad byl neuveritelny.

  78. http://brno.idnes.cz/expedice-vedcu-na-antarktidu-dgx-/brno-zpravy.aspx?c=A130118_155929_brno-zpravy_mav

    Cestu jim navíc zkomplikovala silná bouře a mimořádně tlustá vrstva ledu na moři…

    Taková vrstva ledu na moři, která podle informací od výzkumníků v současnosti pokrývá nejenom průliv Prince Gustav Channel, který odděluje ostrov Jamese Rosse od Antarktického poloostrova, ale také všechny okolní průlivy a zálivy Weddellova moře, na místě v lednu nebyla minimálně 25 let…

    Jestli to není ten led, co ubývá v Arktidě 😉

  79. Andy,
    když tak čtu vaše důvody pro Karla Johannese, vytanulo mi na mysli jedno přísloví: „Tonoucí se i stébla chytá“ 😀 😀 😀

    Dneska jsem někde četl, že je úplně jedno, jestli člověk dostane facku pravou rukou, nebo levou. Ale je mu líp, když si dokáže zdůvodnit, že pravačkou to míň bolí.

  80. no právě, ta slova byla odevzdána jako úkol k zápočtu. Pak dělal plakát k Wesi
    Andersonovi( vztahující se k osobě, ne některému filmu), to bude na výstavě…rozjel se dobře. Začínám si říkat, že to nebude promarněný čas.

    Určitě můžeš…koneckonců návrhy na sirky mu ukradli, ani se neptali.

  81. samozřejmě, ptakopysku, máte recht. Sice mi Koruna česká poslala pdf volebního lístku pro Habsburka, ale nakonec zůstanu realistou.

  82. 85 Jirko ppa etc…také se podívám. Jenže o tomhle a mnohém jiném masová média nic nezjevují. V jejich podání se tu nic nevymýšlí nevyrábí, všichni jsou naprosto k ničemu, samé skandály, kriminalita. Čím hůž tím líp. Každá zpráva je dobrá když je špatná…
    Když žena brblá nad zdejším pronárodem a klesající kvalitou jeho omladiny, přesvědčuju jí, že je tu spousta dobrých, chytrých a pracovitých lidí, kteří dělají mnoho užitečného, jen nemají to píár…Kdysi když byly žně, byla toho plná televize, dnes se ani nedovíme, že nějaké jsou. Jo, nenosí se to, prý „komunistické“. Jenže předválečné týdeníky v kině….

  83. Andy,
    kupříkladu já mám takňák obamy, aby nám stařičký mocnář vydržel do švestek. Oni jsou sice na Homolce kádři a čímani – a jak jsme zjistili u předchozího mocnáře: pár šutráků v posteli vložené milující rukou, vrátí nebožtíka k životu – ale přece jenom…
    Na druhou stranu humorista z Vysočiny….
    Je to těžký rozhodování.

    Teď mě tak napadlo – kdybych se já stal prézou a byl sám jak kůl v plotě… ty současné hérečky, já bych si teda nevybral… asi bych poprosil Jardu Jágra o radu.

  84. když nevydrží do švestek, tak si konečně užijeme pořádný státní funus a bezpochyby přijede pěkná řádka mocnářů z ciziny…což je rozhodně lepší píár než záznam Zemana křupana, kterak si mne podbradek.

  85. Schumi, ono když se přemýšlí o stavu pohraničí a stavu národa, není marné opomíjet první vyhnání a to, že zdaleka ne všichni čeští starousedlíci se vraceli.

  86. Matzurko, děkuji za pěkný článek – trošku mne snad nasměroval do oblasti, o níž jsem dříve nic netušil. Zkusil jsem se pak jen zcela zběžně a povrchně (ostatně jako vždy) podívat na web, a výsledný dojem jsem si do svého primitivního obrazu světa přeložil nějak takto:
    (1) Všichni živočichové mají kdesi v DNA (konkrétně v mtDNA) jistý úsek, který si mezi druhy strukturálně odpovídá, jsa zděděn po nějakém společném prapředkovi – tzn. neexistují živočichové, v nichž by chyběl a jeho funkce byla nahrazena jinou.
    (2) Jeho „obsah“ se v průběhu času měnil mutacemi (taky čím jiným – mtDNA nepodléhá křížení), pochopitelně u různých druhů a v různých vývojových liniích různě.
    (3) Tento úsek lze v DNA lokalizovat pomocí nějaké značky (či dvojice značek) a „obsah“ (tj. DNA barcode) přečíst (jakož i zaznamenat do databáze).
    (4) Různé druhy mají různý DNA barcode, na základě čehož lze původ vzorku určit.

    Je-li to snad opravdu takhle, dovolil bych si několik zvídavých otázek:
    – Jak je ten úsek řádově dlouhý?
    – Mají jednotlivé druhy jen jediný barcode, nebo jich jeden druh mívá více? Kolik asi?
    – Jak moc jsou ty mutace nahodilé? (Kdyby totiž byly zcela náhodné, znamenalo by to, že ten úsek nemá vůbec žádnou biologickou funkci, takže by bylo trochu divné, kdyby existoval u všech živočichů; u některých druhů by se byl býval mohl beze škody vytratit.)
    – Terminologická: Ta značka, o které mluvím, je to samé jako marker ve Vašem článku, anebo se tam markerem rozumí vlastně celý DNA barcode?
    – Ale jak je tomu s mutacemi v té značce samotné? Je snad tak krátká, že v ní žádné nejsou? A pokud jsou, podle jakého kritéria se dá najít?

  87. ptakopysku, ty jako myslíš, že bys třeba držel projev v emerickým kongresu a vzal si tam sněhurku sebou? To jsi odvážný chlapec!
    Tedy úspěch bys měl, o tom není pochyb, ale co potom ta tiskovka?

  88. Ptakopysku, nahodou, si neinformovan. Takove totiz vetsinou vedi, kdy maji chytre mlcet. Kdyby si ostatni z nich brali priklad, bylo by mene rozvodu a vice stastnych a spokojenych muzu. Tahle holt se jeste nepoucila, ci vlastne rozhazuje site na protejsek, to je taky mozne 😀

  89. Půl doby na rozmyšlení koho volit je fuč, přečtla jsem pár článků, shlédla několik reportáží, pr článků, letmo poslechla slovní souboje – zrovna koukám na Primu – a zatím nic nezvrátilo můj sobotní názor – ke druhému kolu presidentské volby nepůjdu, žádný z obou kandidátů mě nepřesvědčil, že je ten nejlepší. Součet jejich plusů a mínusů je stále shodný.

  90. MaYdo samozrejme ze chlapove mohou kojit, kdyz v Sovetske svazu maji leky na pro obeti vrazdy, kdy detektiv pichne injekci do cerstve mrtvoly a pak se v klidu muze ptat, kdo ze ji zabil, proc by chlapi nemohli bejt chodici mlikarna, to je jasne.

  91. Ja myslim ze je dobre ze nam panbuh ty prsa nenadelil. Ja bych se pro same objimani k nicemu nedostal. . . Ne ze by svet o neco podstatneho prisel. . .

  92. Zdravim, Brouku…. Myslim, ze kbyby nas mel panbuh opravdu rad, mely by zeny prsa na zadech. Objimani by bylo takove vrelejsi a konecne bych tomu francouzskemu zvyku porozumel ze 😉

  93. U nas brouku nejsou prsa na zadech nic neobvykleho. Problem je ze jsou vetsinou k nerozeznani od taile…..ale to bejva u vas lidi nekdy stejne,ze ?

  94. Si myslim, ze se pletete, Bobo nemuze byt krava. Vzdyt nedava mleko……. Tady bych tema kojeni a tak, pokladal za ukoncene 😀

    Dobrou noc a moc si tu volbu neberte, bude jeste tyden hnusu, ono to jde vydrzet, kdyz se v tom nebudeme hrabat a kazdy volebni tym si udela tu dvouminutovky nenavisti, pro co nejmene divaku.

  95. (78) Mohl, ale když v ničem jiném, tak ze tohle si ho cením, asi ví, že tím popularitu nedohoní.

  96. 116- na druhou stranu nepochybuji o tom, že pokud by Bobo usoudila, že jí prsa na zádech pomůžou k nějaké funkci, už by je tam měla.

  97. (113) Už dávno. U mne od dob, kdy v ČT vše během chvilky převedla na sudeťáky.

  98. Jirko ppa,
    když někdo nedává mléko, neznamená to, že nemůže trpět laktační psxychózou.
    Fuj, to jsem hnusně impertinentní.

  99. MaYdo ad 107 – v sovětském svazu rozdojili kozla, to je přeci už dávno známé.

    Méně známé je že mužský, i když nekojí, může mít úporný zánět mléčné žlázy. Měl jsem kolegu zootechnika, který rád upíjel čerstvé mléko z Frigery. Leta měl poměrně velké a nespecifické potíže a teprve po letech, když opravdu velmi onemocněl, přišli v nemocnici na to, že chytil zlatého stafylokoka a ten se uhnízdil v redundantní mléčné žláze (to maj všichni), odkud, třeba při nachlazení, vyrážel na nájezdy.Ten stafylokok!

  100. no jóó, Šumaváku, tam přece byli vždycky napřed. Sovětský svaz, náš vzor 🙂

    A nejen zánět, ale i rakovinu prsu můžete dostat, pánové.

  101. Přeji dobrý večer vespolek,
    odpoledne mi bylo jeti několikrát přes jednu z uzlových křižovatek – pro místňáky tu u Výstaviště, a bylo to neuvěřitelné. Sníh pluhy shrnovaly z jednoho pruhu do druhého, takže se skutečně jede po kráterech zmrzlého sněhu na jedničku, neb to klouže jak sfiňa a nikdo netuší, kdo do něho odvedle ducne. Že to kolabovalo včera a byla hodinová zácpa jsem se nedivila, neboť to sníh pořád padal, ale dnes dopoledne zmizly i otravné ledové krupičky a už s tím snad mohli něco udělat… No a ve čtvrti hned u centra zvané Bronx to bylo fakt boží, tam snad projely jen parní válce to udusat, a pak někdo vyšmajdával koleje… tam už to bylo na sněžné řetězy. Z města to nadělení odvážejí náklaďáky, ale všechny tři to asi nestíhají….
    No ale vidím, že tu mám dotazy, takže to vezmu po pořadě.

  102. Varanko,
    kytičkový marker je ve vývoji, přeci jen ten zavedený marker nedával to správné rozlišení. Ale databáze už taky běží, tak se možná brzo dočkáš. Přiznám se, s rostlinným materiálem nemám moc zkušeností, akorát tuším, že jak je tam celulóza¨, musí se do DNA extrakce přidávat ještě nějaká další chemie, aby buňky ráčily svůj obsah uvolnit.
    Co se týká asijských bylinných směsí je druhá věc, v USA se prodával prášek na fertilitu, v němž se prý nacházel i sušený a mletý trus veverek 🙂

  103. Nouze o proteiny v Japonsku samozřejmě je, proto ta rýže 🙂 (aspoň zaplácne žaludek). Z moře baští téměř všechno, kolega evoluční genetik zaměřený na mořské šnečky jednou zoufale povzdechl – to bys měla vidět, co s těmi hůlkami dovedou !
    Na druhou stranu, i některé chráněné velryby se mohou občas odlovit pro vědecké účely, a z nich pak lze i většinu uvolnit pro trh – právě kvůli těm proteinům, ale myslím, že to snad už taky zatrhli (včetně toho lovu) a pokud ne, pracuje se na tom.

  104. Schumachere,
    „junk“ DNA neboli nadbytečné úseky DNA jsou nyní předmětem zkoumání, neboť i když nekódují nějaký důležitý protein (bílkovinu), tak se ukazuje, že mají význam pro regulaci přepisování genetického kódu a podobné detailní procesy na biochemické úrovni. Takže se tomu asi brzo „junk“ říkat přestane. Evoluční genetici mají tyto úseky rádi, neboť na rozdíl od kódujících oblastí je méně pravděpodobné, že by na ně působila selekce – a tak zkoumání vzorce mutování v jejich sekvencích nám vlastně říká, jak by se to vyvíjelo, pokud by to všechno ovlivňovala jen náhoda. A pak je možné lépe studovat i selekci a podobné více formující procesy, neboť máme svůj „nulový“ model, což je něco jako nulová hypotéza ve statistice.
    A ano, bakterie i viry z různých výtěrů a jiných vzorků odebraných pacientům se testují i tímto způsobem – kultivace je ale potřebná k tomu, aby doktoři zjistili nejvíce účinný lék (zatím nelze otestovat z každé baktérie celou genetickou informaci a zjistit, o jaký kmen se jedná – tedy šlo by to, ale kultivací je zjištění nejlepšího léku přeci jen nejrychlejší). Kliničtí genetikové také pracují s řadou „markerů“ pro různá dědičně podmíněná onemocnění; to plánuji rozepsat více v nějakém pokračování, neboť to souvisí i s migracemi dávných národů.
    S tím levným analyzérem jste přesně vystihnul cíl Dr. Heberta – terénní biolog může exempláři utípnout kousek peříčka, lísteček, sebrat chlup na keři přichycený… vrazí ještě v pralese do krabičky, napojí se na databázi, a pak mu to zakuká: „Yetti pralesní“ 🙂
    Teď se to používá kromě kontroly potravin i např. na přesný popis ekonomicky významných druhů, třeba se zjistilo, že dnes opět užívaná pijavice lékařská není jedna, ale asi sedm sobě velmi podobných druhů – tak se zkoumá, která z nich je ta nejlepší (a tu si pak asi patentují). Nebo jsou analyzovány zbytky z povrchů letadel…. pro lepší mapování migračních tras stěhovavých ptáků, aby se jim příště pilot fakt vyhnul…

  105. Andy,
    vy jste jedna, kvůli vám se Zeman nebude exponovat. Cílová skupina, na kterou mířil tenhle fórek, je daleko početnější. Já jenom čekám, kdy si oblékne oblíbené šedé tesilové sako s boulemi na kolenou a vyžvejkanými knoflíkovými dirkami… 🙁

  106. Jirko,
    bude mi potěšením, jen doufám, že nebudu příklad odstrašující, asi bych tvým dětem neměla ukazovat svou Feldinku 🙂 Kdyžtak pak specifikuj stáří potomstva, tento článek se přiznám jsem vytáhla ze svého povídání pro školní mládež (už jsem tu měla i děti z páté třídy, takže se snažím o co nejsrozumitelnější výklad).

  107. Zpátečníku,
    vy si rovnou přineste index 😀 !!!!

    (1) Všichni živočichové mají kdesi v DNA (konkrétně v mtDNA) jistý úsek, který si mezi druhy strukturálně odpovídá, jsa zděděn po nějakém společném prapředkovi – tzn. neexistují živočichové, v nichž by chyběl a jeho funkce byla nahrazena jinou.

    Ano, velmi správně. Přesněji jde o gen pro podjednotku I cytochromoxidázy c, který se nachází v každé bunečné organele zvané mitochondrie (probíhá v ní zejména energetický metabolismus). Mají ho všichni od jednobuněčných organismů až po Homo sapiens, zmutovaný jen do té míry, že je stále plně funkční, u všech buněk stejně.

    (2) Jeho „obsah“ se v průběhu času měnil mutacemi (taky čím jiným – mtDNA nepodléhá křížení), pochopitelně u různých druhů a v různých vývojových liniích různě.

    Naprosto přesně. Tedy, s tím křížením to není tak jednoznačné, ale výjimky potvrzují pravidlo… Selekce ovšem “hlídá”, aby to nezmutovalo příliš, s jistou nadsázkou lze říci, že zde probíhá mutačné-selekční rovnováha (což je jev dynamický).

    (3) Tento úsek lze v DNA lokalizovat pomocí nějaké značky (či dvojice značek) a „obsah“ (tj. DNA barcode) přečíst (jakož i zaznamenat do databáze).

    Ano. celý úsek, jehož sekvenci nukleotidů chci přečíst, označujeme jako DNA barcoding, a v procesu polymerázové řetězové reakce ho vymezím pomocí “primerů” (podrobněji to mám v tom prvním článku).

    (4) Různé druhy mají různý DNA barcode, na základě čehož lze původ vzorku určit.

    Ano, v sekvenci jsou mezi jednotlivými druhy odlišnosti, pomocí nichž druhy identifikujeme.

  108. – Jak je ten úsek řádově dlouhý?
    Zhruba 650 bází, ale u některých zvířat stačí i 450.

    – Mají jednotlivé druhy jen jediný barcode, nebo jich jeden druh mívá více? Kolik asi?
    No, v každé mitochondrii je jen jeden, ale už každá buňka jich má spoustu. Nicméně by se od sebe neměly lišit, neboť tu první mitochondrii má mateřská buňka – vajíčko , jejímž oplozením vzniká zárodek, a všechny buňky dospělců pak mají mitochondrie s téměř identickými kopiemi. Jde zde o tzv. maternální dědičnost, tedy přenos v mateřské linii – mitochondrie máme po svých matkách, babičkách, praprapra…. pramatce Evě 🙂 Spermie přispěje k tomu zárodku ve většině případů jen genetickou informací z jádra bunečného, otcovská mitochondrie pronikne při oplození do vajíčka jen velice výjimečně. Takže pokud tím barcode označujeme opravdu jen tento vybraný úsek, má jich každý druh hodně, ale téměř identické. Téměř znamená, že se i jedinci navzájem mohou lišit, ale jen ve velmi malém procentu bází (zhruba do 2 %), zatímco rozdíly mezidruhové jsou asi 10x vyšší.

    – Jak moc jsou ty mutace nahodilé? (Kdyby totiž byly zcela náhodné, znamenalo by to, že ten úsek nemá vůbec žádnou biologickou funkci, takže by bylo trochu divné, kdyby existoval u všech živočichů; u některých druhů by se byl býval mohl beze škody vytratit.)
    Mutace jsou nahodilé velmi, i když existují úseky DNA, kde to zatím z neznámých důvodů “mutuje” více a jinde méně. Jenže, tady přichází ke slovu jednak genetický kód a jednak selekce. Genetický kód je degenerovaný – tři báze po sobě jdoucí ve specifickém uspořádání (tedy jak složení bází, tak i jejich pořadí, TAC není totéž jako TCA či ATC) kódují jednu aminokyselinu. Báze jsou čtyři (GATC), v trojici se mohou opakovat (GTT), aminokyselin je pouze 21 – takže se může stát, že jedna aminokyselina je kódována více různými trojicemi. Nejčastěji se tyto trojice liší v bázi na 3. místě v pořadí, a pokud tam tedy vznikne náhodná mutace (A se třeba změní na T), tak to pořád bude kódovat tutéž aminokyselinu. Naopak, změna na pozici 1. a 2. aminokyselinu změní, a pak záleží na tom, jestli se ta změna významně projeví v životaschopnosti onoho jedince – buď chcípne (dost tvrdá selekce), nebo bude neduživý a postupně jeho rod vychcípá (a s nimi mutace zanikne), nebo naopak bude statnější s více potomstvem . V tomto případě se pak může stát, že potomci potomků mutaci rozšíří v celé populaci a stane se tím mezidruhovým znakem, pakliže zároveň proběhlo i rozrůznění druhů (speciace).

    – Terminologická: Ta značka, o které mluvím, je to samé jako marker ve Vašem článku, anebo se tam markerem rozumí vlastně celý DNA barcode?
    Markerem rozumíme celý úsek, který namnožím a jehož sekvenci chci přečíst. Ty “zarážky” (koncové značky) daný úsek vymezující jsou “primery”; od nich začíná syntéza DNA.
    Nicméně “marker” je velmi široké označení – v podstatě je to jakýkoliv dědičně podmíněný znak, pomocí něhož jsem schopna popsat nějaký proces či identifikovat jedince.

    – Ale jak je tomu s mutacemi v té značce samotné? Je snad tak krátká, že v ní žádné nejsou? A pokud jsou, podle jakého kritéria se dá najít?
    Primery jsou opravdu velice kraťounké, obvykle je to okolo 21 bází. Ty, které si nechám uměle syntetizovat, by mutace mít neměly. Jim odpovídající úsek v extrahované DNA samozřejmě mutaci obsahovat může. Pak záleží na tom, kde ta mutace je, a o jakou změnu se jedná – do určité míry totiž syntetický primer může s “podkladovou” DNA párovat, a syntéza proběhne. Pokud se ale nespáruje, tak mám smůlu a musím si zvolit primer kousek jinde a nechat syntetizovat znovu.
    Pro navrhování primerů existuje několik pravidel, aby měl pro syntézu optimální vlastnosti, ale to se týká zejména jejich délky, pořadí a složení bází.

  109. Matzurko, hlavně jestli ten veverčí trus poskytoval žádoucí účinky 🙂

    Konec konců cibetková káva je velmi ceněná a v podstatě je to taky trus. 🙂

    Čínské čaje – s nimi jeden nikdy neví.
    Dcera našich kamarádů měla vážné zdravotní potíže, kritický nedostatek krvinek, rodiče zoufalí a nakonec zkusili nějakého číňana, co provozuje čínskou medicínu. Holka dostala jakési podezřele vypadající a ještě podezřeleji páchnoucí byliny a pila z toho odvar – a zabralo to. Tedy – na první kontrole několik týdnů po návštěvě u číňana najednou pronikavé zlepšení krevního obrazu, Doktorka si to neuměla vysvětlit. Čert ví, jestli to bylo to bejlí nebo jetsli najednou zabrala klasická léčba nebo jetsli „víra tvá tě uzdravila“. Když jsme se viděli naposled, byla holka cca rok v pohodě. Už jsme se dlouho neviděli, tak snad jsem to nezakřikla a trvá to.

  110. Dobré ránko!

    Zatímco se tu „vesele“ plácáme v naší smrduté volební loužičce, nějak si nestíháme všímat, že nám Eunie za zadkem těžce selhává v bezpečnostní a obranné politice.

    LA TRIBUNE: Neviditelná ruka Evropy
    …Zdá se, jakoby Unie v podstatě seděla na lavici obžalovaných – nezúčastňuje se operace, na krizi nereaguje, jako vždy je úplně k ničemu a Francie si se situací musí poradit sama. Z politického, finančního a humanitárního hlediska to objektivně není pravda, ale co se týče společné obranné a bezpečnostní politiky, jde o skutečné selhání…
    http://www.presseurop.eu/cs/content/article/3289251-neviditelna-ruka-evropy

    SÜDDEUTSCHE ZEITUNG: Evropané se neumí bránit
    …V evropském zájmu je zabránit islamistům a teroristům získat Mali. Již více než rok si je Unie nebezpečí vědoma. Mali v rukou Al-Kajdy a jejích přívrženců by se stalo Afghánistánem za dveřmi Evropy. Stalo by se výchozím bodem, výcvikovým táborem a odpočívárnou mezinárodního terorismu…
    http://www.presseurop.eu/cs/content/article/3277501-evropane-se-neumi-branit

  111. Jé, to je krásné čteníčko. Konečně nepolitika. No a jak psala Varanka o paní bylinkářce, asi si po ránu dala čajík z Mařinky vonné, aby měla lepší den.

  112. Zdravím !
    Dočítám příspěvky a začínám si připadat jako Alenka v říši divů a za zrcadlem lol

    Milá Andy, dovolím si doporučit nepoužívání slov jako „obrsvině“ apod.; jsou totiž jako bumerang !
    Ostatně v zájmu spravedlnosti měla by být tímto výrazem poctěna také Jeho „ušlechtilá“ Jasnost,
    která obdobně nechutným výrokem „vykopala mrtvolu“ E.Beneše 😕 („To, co jsme v roce čtyřicet pět spáchali, by dnes bylo označeno jako hrubé porušení lidských práv a vláda pana Beneše by se ocitla v Haagu.“) To, co se dělo předtím , ovšem taktně nepřipomenul.
    Když si vzpomenu na Váš výron odsuzující ohledně údajných „neonacistů“, nemohu se v kontextu s výrokem jeho JJ přestat podivovat nad Vaší „obhajobou“ hitlerových „adlátů“ v uniformách SA a SS , byť s predikátem.:-?
    Osobně také považuji za vrcholně nechutné vyhrabávat špínu anebo zásluhy v prezidentské kampani (a nejen tehdy) na předky a potomky(jako by mohli za pitomosti spáchané v minulosti či budoucnosti) , a také na přátele a známé . Musím ovšem konstatovat , že PR a média ( se souhlasem obou protagonistů) stylizují postavy obou buď do světce anebo ďábla , namísto aby objektivně posoudili a zhodnotili jejich činy , které- mohu-li mluvit za sebe- ani z jednoho světce ani symbol hodný následování nedělají 😕

    A k těm čajům ( což je alespoň radostnější téma): v Jihlavě existoval (a snad existuje) obchůdek, kde lze zakoupit čaje z celého světa, a také čaje pro každou situaci např.čaj Einstein (pro zlepšení inteligence ). 🙂 Nezbývá než litovat, že tento čaj nedoznal rozšíření mezi politiky (a také mezi všeholidem):-(

  113. Matzurko – já se jen optám – jak dlouho se nad tou DNA vlastně bádá? 🙂

  114. (136) Ježíši, média …posoudila -sorry -(

  115. Aaaa hlavy z uzenacu….. Asi by se tady dobre prodavaly….

    Ptakopysku, jsem zvedavej, s cim se prijde pristii tyden, protze, kdyz jsou uz dnes takovyhle hnusarny, dojde i na to tesilove sako a radiovku, popripade osoupanou kozenkovou brasnu. Mozna se vyjadri nekdo z ze vzdalenejsi casti rodiny pana prezidenta 😀

  116. Dano, nakoukni do diskuse – už je chtějí stavět ke zdi.

    Chmurné scénáře – odboráři svolají akci na Václavské náměstí, mezitím iDnes v rámci svobodného přístupu k informacím vyzpovídají všechny sousedy kolem jejich domů a ženy z lidu budou říkat: To bychom do něj nikdy neřekli, byl spíš takový tichý. Součástí rozhovoru bude marné zvonění na zvonky s detailním záběrem jména, pak švenk na ulici a číslo domu. Odboráři potáhnou k domu a nešťastnou náhodou se jeden z nich opře o dveře. Po pěti minutách klidné diskuse vyletí oknem na ulici bezvládné tělo mladého právníka – Dobře mu tak, když ukradl miliardy!

    Koudelka je v Brně, tam se takové věci dělají jen, kdyby nefandil Kometě. Jákl má Hradní stráž. Cíl je jasný.

  117. Dobré nekalamitní ráno vespolek,

    tak souboj kandidátů se dle očekávání změnil na nechutný cirkus, tak nemám, co bych k tomu dodala. Raději se budu držet svého…. pipety 🙂

    Rputi, no, o DNA jako takové se ví už od konce 19. století, ale byla ještě dlouhá cesta poznání… Pro ten současný DNA Barcoding bylo asi stěžejní objevení metody, jak přečíst onu DNA sekvenci, což se odehrálo 1975/77. Ale opravdu ve velkém měřítku se to začalo používat, až když se stalo snadným požadovaný kousek namnožit technikou „PCR“ v r. 1983 (viz třeba animace zde http://www.dnalc.org/resources/animations/pcr.html). Databáze se sekvencemi genů GenBank vznikla před třiceti lety (všechny údaje tam jsou volně přístupné, i když dneska už si taky kuliferdové začínají své sekvence patentovat), zhruba před dvaceti lety vznikla opět bezplatná databáze „vyhledávací“, kam můžu nakopírovat svou zájmovou sekvenci, ono to porovná se všemi dostupnými v databázích, a pak mi vyplivne, čemu se ta moje nejvíce podobá (tyhle databáze tvoří bioinformatici, kdepak biologové :)…). Samotná iniciativa Barcode of Life byla založena v r. 2003, a mohutně sílí, i když sklízí i kritiku.
    Lidský genom byl osekvenován (tak se tomu říká) čili „přečten“ v r. 2001, jenže to jenom znamenalo, že známe to GCCTAATGACGACTAGACTAGGCATGACA…., ale nikoliv, co všechno jsou jednotlivé geny, co způsobují, a co dělá ten zdánlivě nekódující zbytek. V podstatě se ukazuje (také díky sekvenování dalších genomů a jejich srovnávání), že i ty nekódující oblasti jsou důležité.

  118. Matzurko, já děkuji.
    Ono je to dobré jako ilustrace (nejen) mých tvrzení. Ono to poznání je cesta dlouhá, trnitá a nákladná.
    Dneska už se nemusí nikomu vykládat, že se vyplatilo … 🙂

  119. Takže v důsledku můžu být rád, že moudrý Kalousek se svojí squadrou zvyšuje daně a moudře rozhoduje, na co se dají peníze. Dokonce i chlíveček na DNA se najde. Ó, jak jsem rád, že se ilustrovala nejen Rputina tvrzení.

    Ještě, že jsem tak starej. Budu sedět na lavičce před domem a přiblble se usmívat. A budu v kolektivu oblíben.

    Dnes jsem se opravdu po ránu nenaladil.

  120. Matzurko, zajimalo by mne, opravdu, jak se v tech organizacich a strukturach zapojili statni instituce, soukrome university, mlikari a pekari a tak. Abych byli usetreni hloupejch poznamek , jako je treba ta od Rputi

  121. Rputi,
    finanční stránku věci bych do toho asi moc nemotala… a podtrhla tu trnitost. Já jsem začínala sekvenování téměř původní metodou, s použitím radioaktivity, někdy v půlce devadesátých let. Dneska na to máme servisní laboratoř, která za zlomek času a podstatně nižší cenu toto udělá za mne, a používá se fluorescence, laser, všechno snímá počítač. I DNA extrahování může být automatizované, a v centru pro barcoding mají skoro automatizovanou linku, kde na jedné straně nastrkají zkumavky na plotničku pro 96 vzorků, a na druhé kontrolují kvalitu sekvencí. Ale tu technickou stránku věci vymakaly firmy, kterým byl jasný potenciál využití v medicíně – i tu DNA nemusím extrahovat pomocí vlastnoručně namíchaných roztoků, ale koupím si standadizovanou soupravu, ušitou „na tělo“ mému mateirálu (soupravy čili kity jsou dnes na ledaco, od vzorků forenzních až po klinické i ty z pralesa).
    Bez těch počítačů, fyziků, biochemiků a dalších bychom pořád byli v počátcích.

  122. (141) kdo chce, pochopí, kdo nechce pochopit, pro toho je další vysvětlování zbytečné 🙁

  123. Kalousek je sice chemik, ale proč ho tam martine pleteš? 😀

    Jiřiku – jasně, že tam byla spousta mlíkařů a pekařů – těch, co si to dovedli spočítat, že se vyplatí… ono to to mnohdy tak na začátku nevypadá. 🙂

  124. Tak az si tenhle lokajský národ zvolí Kalouskovo fořta, nebude se už nikdo ptat na důvody alokace daní.
    Prostě to bude děláno pro blaho naroda moudrym knížetem Potemkinem.
    Nakonec: ma to jít do vědy nebo na dotace? Vovčane plať!!

  125. Snažně prosím,
    nechte toho. Je naprosto nemožné to rozparcelovat, kdo komu za kolik a jaký podíl zásluh – je to fakt tak prorostlé, že pokud bych chtěla použít něco hodně zjednodušeného, nazvala bych to symbioza.
    Třeba Kerry Mullis, Nobelista za PCR, vystudoval státní školy včetně PhD, ale to PCR objevil jako zaměstanec biotechnologické firmy.

    Prosím, prosím, stopněte nesmyslné hádky, na to stačí ti „kandidáti“, ne ?

  126. Prostě si to někteří dovedli spočítat a ostatním to bylo spočítáno.
    Se Matzurko nedivte, blíži se doba daňových přiznání, opět silniční daň … To bude seznam platebních příkazů plný symbiozy 🙂
    No a pro doktora ještě jednou-kdyby se lidem ty peníze nevzaly, kopuili by si za ně auto nebo to prochlastali nebo jeli na dovolenou nebo na muzikál od Davida a nebylo by na silnice v obci a genové sekvencery a vykopávky v Asuánu a filharmonické orchestry. Je to jasné ?

  127. Dobré zas ráno… Tak jak vidím, během mé nepřítomnosti se nic zvláštního nestalo. Snad jen napadaly ňáký ty kalamitky…
    Jinak všade nablito, jako obvykle. Obdivuji genialitu První Brandtovy věty…

    Inu aléééé! Pes jitrničku sežral, sežral ji maličkou – a dál to přece znáte, ne?

    A jdu radši zas kroutit volantem…

  128. He he..
    Matzurko skoda, opravdu mi to zajimalo, jak se podilely na vyzkumu soukrome instituce. Preci jen, tusim ze nejen v „malo“ projektech se podilely velmi mnoho. Je to totiz velky kseft, ta „nadstavba“ . Na druhou stranu, bych se docela prel o tech velrybach. Ne tedy ze se lovej a jedi, ale nektere dokonce zdatne prosperuji a taky je to takovej hezkej mytus pro greeeenpiiiiis, ze jich ubejva. Nejvice pro velryby udelaly totiz ti co zacali vrtat naftu a prestalo se s nima svitit

  129. Matzurko, díky za hezkej článek. Původně jsem se chtěl na něco zeptat, ale Zpátečník to udělal už za mě (a podstatně líp, než bych to udělal já sám).
    Bývá už mi jen taková „divná“ otázka: jaká jsou při určování druhů rizika omylů, přesněji jak často k takovýmto omylům při určování dosud docházelo ?

  130. 157-to by mohlo vysvětlit i to, proč Mayové neznali kolo, ptakopysku. Chybělo jim ministerstvo průmyslu, školství a mezirezortní komise pro podporu vědy !
    A tak se prachy valili do pyramid a hřišť pro pok-a-tok a tak to i dopadlo 😉

  131. NoName,
    jj chvíli jsem dumal, jestli někdy byla, nebo někde je na zemi referenční remě, kde by se základní výzkum nedělal v režii státu a která by byla na vyšší úrovni než je euroatlantická civilizace. Žádná mi nepřišla na um. Vy o nějaké víte?
    Atlanťané, ani Lemuřané po sobě žádné důkazy nenechali… ale třeba to byly durchumdurch ekologické civilizace a poslední jedinec, dřív než vymřel, po nich všechno uklidil a zrecykloval? 😀

  132. A s velrybama je to tak jak říká Jirka – to, že velryb celkově ubývá, je skutečně mýtus.
    Ve skutečnosti už dnes, pouhých 40let po skončení hromadného lovu velryb, se celá řada velrybích druhů vzpamatovala natolik, že jich jsou zase statisíce …

  133. Ptakopysku, spousta slov už dávno ztatila svůj původní význam.
    „Referenční remě, kde by se základní výzkum nedělal v režii státu a která by byla na vyšší úrovni než je euroatlantická civilizace“ je taky fráze. Taková z množiny jiných: že věda a vzdělání se má podporovat, učitelé lépe platit … Kdo by to všechno nepodepsal a nesouhlasil s tím ?
    Ale protože to končí nakonec vždy u těch blbých peněz, které se musí někomu vzít, aby se mohlo něco hodnotného podpořit, je přece jenom nutný (snad ještě pořád) nějaký kompromis ? A ten nevznikne tak, že se plátci sdělí, že je blbec a že by tomu i tak nerozumněl, takže stačí, když zaplatí a nebude se vyptávat ?

  134. Ptakopysku, já vážně nejsem žádný nepřítel vědy, vzdělání nebo kultury. Ale nějak necítím potřebu to neustále deklarovat, zato mne dost zajímá, jak to prakticky udělat ? Ten blbec pekař nebo mlíkař chápe ekonomické zákonitosti dobře, jinak by ekonomicky nepřežil, je logické, že se dožaduje informací o tom, jak respektují ty samé ekonomické zákonitosti instituce, které po něm chtějí peníze. A tomu, že je to tak složité, že to pekaři vysvětlit nejde snad nevěříte …

  135. Muhehe,
    ty titulky v novinách mě snad zabijou. „Mladý Klaus čelí bouři studentů a rodičů“
    Škoda přeškoda že neumím malovat, jako uměl trebárs Vernet, kterej mastil jakékolif bouře jak na běžícím pásu. Ten kdyby žil v současné době, zobrazil by mladého Klause doširoka rozkročeného na parketách svého gymnaziálního shipu, an třímá v ruce složku s nápisem Nařízení ředitele a urputně hledí na masu studentů, rodičů a přátel školy.
    Nebo Rembrant, ten dokázal namalovat i bouři ve sklenici vody http://www.worth1000.com/entries/97109/excuse-rembrandt , takže výše uvedené téma by zmáknul levou rukou s přivřenýma očima.

  136. tučňáku,
    jojo, svatá pravda, třeba v Sydney na Whale Beach jich bejvá tolik, že člověk musí jít půl dne po velrybích hřbetech, než uvidí volnou vodu. A když je tah, tak kvůlivá plejtvákům se tankery a containerships nedostanou ani na dohled majáku na Barrenjoey, protože by před nima musel plpout ledoborec.
    Si dělám hýždě… když uvidíte zeshora ze skály na Barrenjoey velrybu, tak máte zážitek na rok a vyprávíte o tom všem kamarádům a oni na vás závistivě čučej. Ale byly doby, kdy tam opravdu nebyl problém nadechující se velrybu vidět. Tehdy tam byl asi pradědeček Jirky ppa a teď tu na nás Jirka machruje 😀 😀 😀

  137. NoName,
    no, ono to asi nejde. Doba, kdy někdo rozuměl úplně všemu, co tehdejší lidstvo znalo a dokázal si to dát do souvislostí, skončila s Leonardem da Vinci. Teď prostě musíme věřit tomu, co nám odborníci tvrdí o svém výzkumu a jediná verifikace užitečnosti vložených peněz je v komerčním použití výsledků základního výzkumu. Průseř nastává, když je mezi odborníky nadkritické množství šíbrů. A přiznávám, naprosto netuším, jakým algoritmem je včas odhalit.

  138. jestli se někdo chcete mrknout, jak vypadá Barrenjoey Head

    tady: http://www.ptakopysk.cz/Prani/P1000783.JPG je pohled z pláže
    tady: http://www.ptakopysk.cz/Prani/P1000805.JPG je cedule odshora pro ty, kteří uvidí velrybu a chtějí ji identifikovat
    tady: http://www.ptakopysk.cz/Prani/P1000802.JPG je pohled shora na pláž, odkud byl focen první snímek
    tady: http://www.ptakopysk.cz/Prani/P1000788.JPG je pohled z buše nahoru na útes. Ty drobnolisté keře jsou teatree
    tady: http://www.ptakopysk.cz/Prani/chatrc.JPG v takovýchdle chatrčích bydlí místní domorodci na Barrenjoey Head

    Všechny fotky jsou foceny uprostřed kruté Sydneyské zimy, proto jsou pláže liduprázdné.

  139. ano, dost politiky, tak teda kultůru
    a…..bořka šípka k tomu v rozhovoru
    http://www.denik.cz/z_domova/vytvarnik-borek-sipek-po-havlovi-to-je-na-hrade-katastrofa-20130118.html

    tak teda kromě politiky, kdy demokracii ano, ale jen pro ty inteligentní
    a umění: “ Když jsem na Hradě začínal, pozval jsem Hanze Holleina, vynikajícího rakouského architekta světového jména. Procházeli jsme spolu Hradem a já se ho ptal, jestli by se dalo to či ono vybourat.“

  140. No, obávám se, že rozpočítat ty finance v celé šíři by se asi nepovedlo nikomu, a já vážně nejsem kouzelník..

    Stran velryb, jen jsem citovala z literatury. Jestli mají pravdu nebo ne nechám na posouzení čtenářům, já víc o těch kytovcích nevím – leda je uctivě pobdivuji v Sea Worldu (ano, jsem velkým fanouškem Shamu Show), a při výletu na Hawaii jsem překonala mořskou nemoc (nadopovaná kinedrylem), abych na malé lodičce vyjela na „whale-watching“. Což bylo korunováno úspěchem, jedna zvědavka se na nás přišla podívat, ksichtík ukázala, ocáskem zamávala, a já to zvládla taky :o)

    Tučňáku, ke speicifcké otázce ohledně druhů. Věc se má tak, že pojem „druh“ je dost ošidný, existuje zhruba 18 různých definic… já osobně používám „evolučně-genetickou“, tedy že jde o skupinu jedinců, kteří obývají stejný čas, mnohdy i prostor, a hlavně se mouhou navzájem křížit a vytvářet životaschopné potomstvo (třeba paleontologové tyto definici použít nemohou z celkem zřejmých důvodů). Navíc toto vymezení chápu nikoliv jako neměnné, neboť evolučním procesem se třeba morfologie může měnit, a samozřejmě se z jednoho druhu nakonec stane jiný, někdy i více jiných. Takže tímto je omezen i Barcoding, takže se zavedlo jednoduché, ale arbitrární, pravidlo, že vnitrodruhová variabilita by měla být 10x nižší než mezidruhová. A jelikož je to vlastně umělé, lidmi vytvořené pravidlo, tak se kvůli tomu vědci hádají… ne vždy se totiž tohle podaří naplnit. Ale vedlo např. k tomu, že se zjistilo, že skutečně dvě populace téhož druhu jsou geneticky velmi rozdílné (pouhým okem ale nerozlišitelné, a taky vždy nejde zkoušet to křížení a životaschopnost potomstva), takže se nakonec označí za druhy kryptické. Naopak se může stát, že velmi dobře popsané druhy, odlišné morfologicky i ekologicky, jsou na úrovni tohoto markeru nerozlišitelné. On se totiž vyvíjí i ten marker, u některých skupin rychleji, u některých pomaleji, a tento gen byl vybrán právě jako s „nejvyrovnanější“ evolucí.
    POkud teď lovím z paměti, tak třeba u nějakýchz tropických motýlů jeden druh rozdělili na asi pět (dodatečně se zjistilo, které housenky k nim patří, a co žerou – tedy pomohlo to se zaměřit na detaily), naopak u žab a mořských korálů to bylo celkem na nic. Holt, ve vědě je řada slepých uliček. Jak to vypadá s procentem neúspěchů nevím, on je totiž raději nikdo moc nehlásá… 🙂

  141. (140) Lidovky z toho Hasenkopfa nepodezřívají. Píší o jeho odmítnuté variantě, za přijatou prý je Koudelka.

  142. (159) to už jsem psal také, ale nějak to zapadlo.
    Asi je zábavnější se hádat, co by mlékař a pekař …..

  143. ptakopysku 165 – pár poznávacích znamení by se našlo.
    Šíbři všeobecně neoblibují exaktní obory, tam se musí moc dokazovat a často se to dá spočítat, což je strašnej opruz. Vůbec mám pocit, že spolehlivé znamení je, jak začne někdo hlásat, že matematika je na dvě věci a matura z matiky zbytečná. V tom případku nutno okamžitě zpozornět.
    Takže se shromažďují zejména na oborech okecávacích, což jim dnešní doba, se svou zálibou v inťošském plkání náramně usnadňuje. Zajímavé je, že jakmile se někde takový šíbr usadí, začne se množit dělením a najednou, místo jednoho, dvou sociálních ekologů v rámci katedry sociologie je z toho zničehož nic samostatná katedra. Dtto genderstudies atp….V tomto vyniká Masaříkova universita, kde se to množí, jak houby po dešti.
    Není-li zbytí, tak se holt výsledky zfalšují viz IPCC, kde je to jeden šíbr vedle druhého.

  144. Matzurko, díky za rozepsání o druzích.
    Já jsem se ptal vlastně proto, že chytré knihy a atlasy zvířat berou obvykle genetický důkaz o rozdílnosti druhů jako nezpochybnitelný a mně se to právě tak úplně nezdálo, už jen kvůli tomu časovému vývoji.
    A pak je v tom zazívá u mě i jistý osobní tón – když už se konečně prohrabu atlasy a podaří se mi určit, jaké zviřátko jsem to vlastně viděl, tak mě poněkud demoralizuje, když zjistím, že jsem podle genetických důkazů viděl něco úplně jiného …

  145. Ahoj!
    Ten Šípek ( ad 167) našel mezeru na trhu!
    V Číně už mají Benátky, Hallstadt… ale pražský Hrad ještě ne. Takže až je přesvědčí, aby ho také postavili, může tam pak bourat co hrdlo ( a číňani, ne památkáři) dovolí… 🙂

  146. Matzurko – díky za zajímavé a skvělé počtení.
    Rozumím tomu správně, že to, co popisujete (určování druhů) se týká
    celé jen mitochondriální DNA ? Někde mám v hlavě, možná z Vašeho prvního článku,
    že mtDNA obsahuje jen 27 genů ale DNA z jádra buněk jich má 20 000.
    A teprve zkoumáním té jaderné DNA bychom se dopracovali k výsledku, zdali zkoumaný materiál je Franta Vopršálek či Lojza Vemtyvidle ?

  147. Dopbré poledne,

    nějak jsem si vzpomněla, matzurko, na grygarovo tvrzení, že poznání je jako osrov, který se vynořuje z vody- Čém víc pevnoíny je odhaleno nad vodou, tím delší keje hranice mezi pevninou ( to, co známe) a možem neznáma, které čeká na odhalení.

    Dnes jsem hledala, něco v kuchyni a ze skříňky na mně vypadla krabička s nápise, „první pomoc – čaj proti alergii na školu“.
    Podle složení zelený čaj, chrpa, divizna, sušená papaya a kokos.

    Politika – včera jsem se babičce pokoušela vysvětlit, že opravdu Klaus ml. nezískal svoje místo ředitele PORGu tak, že ho tam „tatínek upíchl na teplém místečku“. Přitom byly doby, kdy ho obdivovala jako ostatne vše, co se Kaluse týkalo a běda, kdybych se opovážila vyslocvit názor, že v tomhle nebo onom Klaus, ať už starší nebo maldší ustřelil.

    Prostě mediální masáž dělá divy… A u té babičky ještě nepřiznáný obdiv, že se jedná o šlechtu avliv přítelkyně, která pprostě obdivuje šlechtu.
    Karel je prostě idol stařenek, s tím nic nenaděláte 🙂

    Nejspíš se v dohledné době taky dozvím,jakej darebák je ten kocour a JAkl. Jakl je jasnej, dlouhý vlasy a vousy a je to rocker.:-)

    Matzurko, vždycky o těch genetických souvislostech přemýšlím,když se dívám na chalupě na ptactvo, navštěvující krmítko. Chodí tam tři druhy sýkor – koňadry, modřinky a úhelníčci ( ti ovšem v poslední době málo) a někdy mám dojem, že některé exempláře jako by byly spíš přechodové mezi těmi druhy, že před léty bylo to odlišné zabarvení výraznější

    ale možná jen jsou výrazněji barevní jen ve vzpomínkách z mého dětství . 🙂

  148. No fuj, to je zas překlepů…

    Ad Šípek, ten přece dělal Havlovu knihovnu a snad i další zařízení jeho pracovny a po skončení Havlího panování ji zase rozebral a odvezl. Mám dojem, že to pak střelil nějakýmu milionáři.

  149. Jojo, Hrad vybourat, a postavit „evropskou vesničku“ !!! Už se nemůžu dočkat…

  150. Tak jsem uvolnil výjezd z garáže a jdu zkusit dojet do duty free pro rum a kafe…

  151. ptakopysku (164), já tím myslel něco trochu jinýho:
    jak neuvěřitelně rychle se dokážou vzpamatovat populace velryb, když po desetiletích systematického vybíjení (cca 800 tisíc velryb) jsou dnes jejich počty na deseti- až stonásobcích původních stavů. Po pouhých několika málo generacích – vždyť s komerčním lovem se přestalo ve velkém až kolem r.1965 a úplný zákaz přišel až někdy kolem r. 1980 (jestli si to dobře pamatuju).
    Třeba v antarktických vodách je dneska velryb už dost a není problém je vidět každý den. Ale než se velryby vzpamatují natolik, aby se zase připluly podívat na sydneyskou operu, to holt ještě chvíli potrvá.
    Mimochodem, tobě se tam podařilo velrybu zahlídnout ?

    A k tomu původnímu, na co narážel Jirka – tedy ubývání velryb a gríínpis – bych přidal pár čísel: např. u jedné z menších velryb, plejtváka malého, se dnešní populace odhaduje na cca 1.2 – 1.4 miliónu ks. Takže těch zhruba 200-400ks velryb, které žaponci ročně uloví (z nichž většina je právě tento druh), zase nejsou žádná tragédie.

  152. Tučňáku,
    buď v klidu a atlasům klidně věř – na úrovni rodů je to docela jasné, to jen ty druhy a poddruhy už jsou občas nejisté. By ses divil co specialista taxonom dokáže vyprodukovat – žes viděl nejen vrabce obecného, ale podle zahnědlých pírek u zadečku a žlutého fleku pod levým okem to byla forma východní a typická pro Pobaltí a k nám to zalítlo jen díky silným větrům…. :o)

    MaYdo, ony totiž potvory i někdy velmi tradiční a dobře rozeznatelné druhy klíďo píďo na nějakou genetiku a taxonomii kašlou a klidně se zkříží… ale potomstvo už může mít potíže, nejenom že třeba vypadá neobvykle, ale i třeba metabolické nedostatečnosti atd.
    A i v tom vzhledu existuje spousta variant, takže ano, může jít o zimní či letní vybarvení, leckdy se i samečci vybarvují více v době páření (viz nalákat samičku) a podobně.

    Oteplovači,
    tento jediný konkrétní marker je skutečně na mitochondrii, a je to jen kousek jednoho ze zde umístěných genů. Takže není nutno sekvenovat mitochondrii celou (i když dnes je to už snadnější), navíc by to asi nepomohlo – různé geny se evolví různou rychlostí, takže například jiné geny z mitochondrie se používají na určování čeledí, načeledí a vyšších taxonomických skupin.
    Naopak žádný z mitochondriálních genů nestačí na identifikaci jedince, na to se skutečně používají markery z jaderného genomu lokalizované na chromozomech, a dokonce to jsou právě ony nic nekódující oblasti (tzv. mikrosatelity, ale detailněji asi vážně v příštím článku). V daném případě se jich ale musí použít celkem 12 (třináctý je pro určení pohlaví), a neurčuje se přímo sekvence, stačí jen velikost daného úseku (ta variabilita je taková, že úsek může být veliký třeba 120 bazí, ale taky 150 bazí).
    Celé se to jmenuje CODIS, a kromě forenzních vědců to používají hlavně kriminalisti.

  153. Tučňáku,
    právě jsi popsal jeden dost důležitý aspekt genetiky populací. Jak už tu zaznělo, mutace jsou jako jediné zdroj variability. Pokud náhle, třeba v důsledku lovu, velikost populace drasticky poklesne, je to průšvih. Totiž, poklesne i genetická variabilita, která se evolvila miliony let…. a pak už je celkem jedno, kolik zvířat se bědem dekády zase namnoží, jsou prostě geneticky chudáci, a když dojde na nejhorší, i příbuzní se všemi negativnímu důsledky (snížena imunita, snížená fertilita, metabolické defekty…). Takže census (počet jedinců v populaci) může být třeba milion, ale pořád jsou to geneticky jen potomci těch dvou desítek přeživších šťastlivců. Pro evoluci dost rána, neb nemá moc na čem evolvit, a mutace se sice počítají i na počet jedinců, ale především na generaci.
    Ale máš pravdu, v milionu se těch 400 hravě ztratí, ovšem do toho nemluví ani tak genetici, jako ekologisti a úředníci….

  154. No jo s tim Hradem….. Kazdej chce zanechat stopu v dejinach. Coz je samozrejme v poradku. Jen bych byl rad, aby to kazdy delal za sve a na svem. Je to tak neprekonatelne chapat? Ty kecy okolo jsou jen nuda nuda a sed….

    Ale vratim se k te genetice a evoluci, coz spolu souvisi, jako vejce vejci. Ted mozna budu velmi, no, bez mantinelu…. Mam takovy pocit, ze cim vice je „novorozenecke“ pomoci, asistovanych reprodukci, zachranovani lidi s „genetickejma mutacema“ plasticekjch operaci, co maji ty vady zakryt……… Je v populaci v podstate tezke, najit nekoho, kdy by nemel neco co drive nebylo tak bezne, protoze se decka nedozila dospelosti a kdyz ano, bylo tezke si najit protejsek.

  155. Tučňáku,
    🙂 nojo, člověk si nemá dělat až zas tak moc srandičky. Já jsem tam cosi zahlédl ve vodě, ale jestli to byl přerostlej delfín, nebo nedorostlá velryba, bůh suď. Spíš ten delfín…
    Menší druhy velryb se vzpamatovávají hodně rychle, protože snad mají výkonnější natalitu, ale velké druhy, jako plejtváci, tam to holt trvá dýl. Dřív těchhle voblud bylo tolik, že když chcíply a šly ke dnu, vegetovaly na nich kvanta krabů, rejnoků, červů a dalších …fágů. Fágové mohli putovat po dně od jedné zdechlé velryby ke druhé, aniž by zdechli hladem sami. Teď je prý těch velrybích mrtvol tak málo, že je tenhle pohřební ekosystém taky na vyhynutí.

  156. Já mám s hrábětem trochu jiné zkušenosti. Kdysi dávno jsem strávil nějaký čas jako drobné, nicméně již trochu myslící, robě v Rakousích(hnusní místní kamarádi mne nakazili č. kašlem a já nějaký čas nemohl přes hranice). V té době žil tento kapitalistický státeček zajímavou causou. Protože náš kníža neměl moc peněz, platil mu školy jeho strýc. On se mu za to měl odvděčit tím, že bude hlídat a dohlížet na jeho potomka, který byl tuším jen o něco málo mladší. Tak nějak se stalo, že se o trochu později pánové vydali do Alp, aby na zdravém vzduchu posílili. V jedné hodposě byl vzduch tak silný, že tam hoši nevydrželi a šli se vykoupat do místního jezírka.Tuším, že to bylo napodzim. Hupli tam po hlavě. Kája vyplaval a ten druhý tam zůstal. Hnusný tisk probíral, zda měl kníža tendenci druhu pomoci. Časem se sjednotil, že nikoliv. Strýc z toho byl trochu smutný a slíbil před svědky, že Káju vydědí. Rozrušen z této úvahy odešel ven do zimy, aby se ochladil, a tam dostal infarkt. A jako v pohádce Kája získal jmění této větve.(Co myslíte, jak asi vyhrál spor s příbuznou o majetek u nás?) Celá záležitost se mi vryla do makůvky z toho důvodu, že v té době si další příbuzná nedala pozor s jedním s modrou krví. Proto byli v této naší rodinné větvi degeneranti velmi neoblíbení a o činu Káji se tam v té době hodně diskutovalo. Když u nás byli letos postarší rakouští příbuzní na návštěvě, neopoměli pošťouchnout, jakou hyenku máme mezi kandidáty. Jakoby Rakušáci byli svatí, že?

    Je až s podivem, že tuto historku nikdo z hlídacích psů české journaloistiky nevytáhl. Možná, že by to v německých pderiodikách brali jenom jako špinění křišťálově čistého a mravného. Mne to nijak nevzrušuje, protože pokud vůbec půjdu volit, degenerantovi to určitě nevhodím. Díky Matzurčině článku prohrabávám knihovnu a hledám knihu jednoho současného našeho vědce, mimochodem jednu dobu častého v radiu Leonardo, který má drobné problémy s darwinismem (alespoň u vyších živočichů). Safra, kam jsem ji jen mohl založit.

  157. Matzurko, pokud vím, tak podobný problém s genetickou variabilitou mají gepardi – tam k tomu kritickému poklesu populace došlo prý asi před 10-15 tisíci lety.
    Ale u těch velryb vlastně nikdo moc neví, kolik jich u kterého druhu zbylo. To se jen odhaduje, většinou tak podle vyprávění velrybářů, kterak se plavili měsíce a nezahlédli ni ploutev. Tedy se ani neví, jestli se příslušné populace druhů pod tu kritickou hranici dostali nebo ne …
    To celé mě ale ještě přivádí k jedné otázce: když „vzniká“ nový druh, tak přece je také jenom velmi malý počet exemplářů. Jak tedy tam vznikne ona genetická variabilita – je to jen otázka času ? Nebo je špatně ten můj původní předpoklad, že nový druh začíná jen „z Adama + Evy“ ?

  158. Zacinat od Adama a Evicky muze jenom panbuh. Ostatni druhy si musi zacit pomalicku, a polehoucku ve vetsim. Nikdo proste neprskne 100000 goril do lesa, ale hezky pomalu, evolucne, se pretvareni ten druh v jedno velkem udoli „o evolucni stupen, nize.

    Frantisku, to chce vobklad a omejvat vvlaznou vodu. Nebo jeste lepsi, posli to Klausovi mladsimu, on to jiste rad uverejni 😀

  159. Omlouvám se za překlepy a nedoklepy. Karpálka se mi zhoršuje a já se bojím doktorů.

    Taky nemám rád delfíny. Posledně, když jsme na červené louži při měsíčku diskutovali na potápěčské plošině (zdálo se nám, že téměř u hladiny je menší vedro), jeden z těch hnusných tvorů vyskočil cca dva m od nás a plácl sebou o hladinu stylem placák. To, že nás do nitky zmáčel, by až tak moc nevadilo. Ale zvláště mně zředil wizoura mořskou vodou. Milí přátelé mi navíc doporučovali přidat česnek a olivu s tím, že mi odporný savec vlastně namíchal coctail tuším s názvem Slunce v Haifě.

  160. ptakopysku, ale já jsem pochopil, že to bylo v hýžďovém tónu, ostatně pro nás méně chápavé jsi to tam i napsal 🙂
    S těma důsledkama lovu velryb je to stejně zajímavé, a to na obě strany:
    Např. kolem velrybářských stanic vznikly neobyčejně velké kolonie mořských ptáků, živících se na velrybích mršinách. Po zavření stanic se populace fóglů rapidně snížily, klidně i na desetinu původního počtu. Takže argumentujeme-li stylem Gríínpíís, tak zavřením velrybářských stanic došlo k zavraždění milijónů mořských ptáků …
    A druhý příklad: díky chybějícím velrybám bylo v moři více krilu a vzniklé zásoby jídla rychle obsadily jiné druhy: od lachtanů a tuleňů přes buřňáky a albatrosy až po ty zpropadené tučňáky 🙂

  161. tučňáku, vzato do důsledku,
    kdyby nevyhynuli nebozí rozkošní dinosauříčkové, tak by se nerozvinuli savci a homo by měl zákonitě smolíka… 🙂

  162. Šumaváku 190 – teď jenom, kterej je kterej? 🙂

  163. Jiříku, věřím, že s omýváním máš dlouholeté zkušenosti.

    Matzurko, je to trochu pro mne problematika trochu hit sun leones, ale například u dobytka se šlechtí linie příbuzenskou plemenitbou. A pokud mám věřit panu Mitchelovi (Havaj), pánům, píším o jihoamerických a egyptských kulturách, tak hlavního dědice musel u vládnoucích vrstev splodit bratr a sestra. Pan Mitchel například uvádí, že šlo (alia)o krásné, až dva metry vysoké lidi, kteří se od ostatních výrazně odlišovali. Nejde tedy tímto způsobem vylepšit genom? Vždyť i našich předků prý nebylo více než tisíc, spíše méně.

  164. Františku, taky jsem měla jeden čas problém s pravým zápěstím, nakonec pomohlo chvíli používat myš levou rukou (je to docela zábava ze začátku ;-)), pak používat pravou důsledně jen s opřeným loktem a občas ji protáhnout na opačnou stranu. A dobrý…

  165. Hygiena je dulezita…. Ale myslim si, ze lesnik prisel k majetku o fous jinak. To vis, lesnici a hospodsti maj i jine „kanaly“ na predavani informaci, nez sedet v hospode, nebo si cist Blesk. Ale je to jedno, proste nechal utopit kamarada, aby jeho , „nekdo“ kdo ho mel vydedit, dostal infarkt, jak proste a jednoduche. Nemohu se prestat usmivat.

    Jen by mne docela zajimalo, co vas na tech volbach tak bere. Bud to fakt prozivate a proto pisete to co pisete, nebo si z toho delate legraci. U nekoho to poznam, ze Ptakopysku, ale o ostatnich proste tu zlobu a nenavist nemohu nejak transformovat na smich. Ale je mone, ze to ani k smichu neni. Coz mne tedy docela desi….

  166. tučňáku 185 – mutace se upevňuje časem. Mutant se samozřejmě nadále kříží s nemutanty, ale když je ta mutace výhodná (jsou větší, silnější, apod.), tak prostě přežije víc mutantů, až se nakonec oddělí jako druh, který se s původními nemutanty už ani nemůže křít.

    Františku, prdlajz! Chuděra Tutanchamon byl mrzák šišatej, paťatej. Podle nejnovějších výzkumů, krom dynastických vraždiček, to byl jeden z důvodů, když dynastie šla do kopru.
    http://neviditelnypes.lidovky.cz/veda-tutanchamonova-rodina-a-nemoci-d6w-/p_veda.asp?c=A100221_111326_p_veda_wag

  167. Tučňáku,
    no… já se snažím klást bojovníkům za uvedení přírody do původního stavu klást otázku, který původní stav mají na mysli. Jestli prales doby nedávné, nebo tundru poslední doby ledové, nebo stepi dob meziledových. Já osobně pléduji za subtropy mladších třetihor. K moři do velké Bíteše bych to měl kousek, šnorchlovat na korálový útesy k Brnu či do Znojma by člověk doplaval na nafukovacím kruhu, všude teplíčko, semo tamo sopčička, zalejvat zahrádku se tehdá nemuselo. Ovšem bojovníci za záchranu planety se na moje návrhy vůbec netváří vrle a nechtějí definovat mnou ždaný „původní stav“. Obzvláště ne, je-li jich víc pohromadě. Je to zkrátka bordel…

  168. Matzurko, prosím vás, ráda bych se zeptala na něco v souvislosti se 182. Počátkem 70.let v genetické laboratori v Motole, na otáku, zda se díky pokrokům v medicíně a s tím související častější záchrana novorozenců s vadou či předčasně narozených, nezhoršuje geneofond populace, genetička odpověděla, že ač se toho obávali, k ničemu takovému nedochází. „Příroda“ se s tím vyrovná.Platí tento názor dosud?

  169. Františku I. jestli ono to u těch egypťanů nebude dáno tím, že vládnocí rod pocházel (prý, podle DNA) ze střední Evropy a vedl bůhví k jakým Keltům… 🙂

    Ta příbuzenská plemenitba se ovšem dělá cíleně s kontrolou, pokud možno nejméně přes dvě generace.
    To ovšem plejtváci asi zmáknuté nemají…
    O středověké šlechtě ani nemluvě.

  170. Kristo, odpověď se nesmí hledat u těch co něco zachraňují, ale u Thilo Sarrazina… 🙂

  171. Rputi, v knize Havaj pan spisovatel dodává v příručce i návod: museli eliminovat všechny úchylky. Prostě mrzáček za dohledu kmene nepřežil a muselo se začít znovu. Pan kněz i paní knězová měli potom další potomky s jinými, ale ti do vládnoucího rodu nepatřili.

    Niko, levačkou manipuluji s myší od samého počátku mého soužití s PC (kancelář jsem budoval ještě v době, kdy jsme se na tyto sarapatičky koukali jako na vůni nebetyčných dálek. Když jsem si tenkrát o něco později koupil za děsivou cenu šedesáti klacků počítač už z W95 a nikoliv Dosem, místo jsem měl u mého milovaného stolu pouze nalevo. Takže jsem dopadl trochu jako ten Dalibor, byť s lepším koncem.). Bohužel píšu všema devíti a donedávna jsem si věřil tak, že jsem po sobě věci ani moc nečetl. Nyní je to průšvih.

  172. no to Ti nezbejvá nic jiného, než kandidovat na presidenta. Tam nevadí nic. 😉 🙂

  173. Františku, knihu Havaj jsem sice nečetla, ale ono je to trochu jinak – Matzurka by zajisté vysvětlila lépe.
    Jednoduše řečeno – potomek může být „zdravý“, ale ty vadné geny v sobě má, i když se u něj neprojevily. A příbuzenskou plemenitbou se prostě počet vadných genů násobí.
    Krom toho, Tutatanchamon, i přes svá postižení, faraonem byl. Měl ženská prsa po tatínkovi, koňskou nohu po dědečkovi a bůhví co ještě…

  174. Tak jsem včera /44/ položil následující otázku:
    Kolik procent telecího masa musí v Německu obsahovat telecí párek?
    A těšil jsem se na odpovědi z kruhů odborných i hospodyňských – leč marně. Tak tedy vězte, že to musí být – Anka bubnuj! – celých 15%. Nicméně německá páteř je soucitná s německým stavem uzenářským a povoluje nahradit telecí mladým hovězím. Pikantní je, že do roku 2008 – až když EU vydala příslušnou směrnici – nebylo v Německu jasné kde je hranice telecí/mladé hovězí, potažmo mladé hovězí/hovězí.
    Myslím, že otázka kolik jater musí být v německé játrovce je už zbytečná.

  175. (179)„jsou dnes jejich počty na deseti- až stonásobcích původních stavů.“
    Buďto jsem nepochopil, co je míněno „původním stavem“, nebo je to dost málo uvěřitelné. Jednak se ty potvory nemnoží masově, ale jedno mládě za dost dlouhý interval, druhak, pokud by „původní stav“ byl před začátkem lovu, pak byl pravděpodobně rovnovážný a daný množstvím dostupné potravy a lze pochybovat, že by jí teď tolik přibylo.
    Nevím, není to můj obor, ale hlodá ve mně jakési podezření na omyl.

  176. Rputi, nepřu se, nevím.

    DVD, kde myslíš, že jsem se učil?

  177. Jinak, u nás to máš snadnější, jak jsem viděl u jednoho velkovýrobce. Tam nemáš žádné hovězí, natož telecí.

  178. NoName – ad 158.

    To, že Mayové neznali kolo je oblíbený omyl. Mayové pochopitelně kolo znali, vždyť jejich kalendář je na principu kola a jeho převodů založen. Mezi archeologickými nálezy je taky fůra hraček, která mají kolečka a byly tuším objeveny i nějaké malby či rytiny které ukazují dělníka který veze kámen na něčem, co připomíná trakař.
    Pravdou ovšem je, že mayská civilisace nepoužívala vozy a kočáry. Ne ovšem proto, že by neznali kolo, ale zde dvou zcela jiných důvodů.

    1. Absence vhodného tažného zvířete – Koně byli vyhubeni na americkém kontinentu dávno před vznikem mayské civilisace, dobytek tam též nebyl a lama se do zápřahu nehodí, tu lze použít jen jako nákladní zvíře (tak jí také Mayové využívali).
    2. Terén je v těch končinách velmi hornatý a nebržděný vůz má jednu ošklivou vlastnost, že se neustále snaží zaujmout bod ve kterém je jeho potenciální energie nejnižší a při této činnosti mění přebytečnou potenciální energii na kinetickou 🙂
    A vývoj techniky od nebržděného vozu k bržděnému nějakou dobu trvá (v Evropě řádově stovky let) a funkční brzdy vyžadují technologii a nástroje řádově lepší než je obsidiánová sekera.

    Kombinace těchto dvou faktorů vede moderní archeology k názoru, že s vozíkem a lamou Mayové sice patrně experimentovali, ale prostě se to neosvědčilo, takže se drželi funkčního konceptu cestování pěšky či v nosítkách a za doprovodu nákladních zvířat nesoucích náklad na zádech. Případně využívali lamy k jízdě.

  179. Aha, Karle (179), dal jsem tam blbou formulaci „původních stavů“. Myslel jsem tím stav populace PO zdecimování lovem, tj. ten nejnižší stav. Sorry, špatná, špatná slovíčka.
    Původní stav, tj. před zahájením lovu velryb, je nejspíš už nemožné zjistit – mj. proto, že do hlavních oblastí výskytu velryb se člověk tehdy vůbec nedostal a ani je neznal (Antarktická konvergence).

  180. A Karle, když tě tu vidím, zkoušel ses začíst do toho Zajdela ?

  181. Pane Tucnaku, ono vubec je tezke posuzovat „co bylo drive“ kdyz to lidi nezajimalo jinak, nez pres „harpunu“
    Ono vubec s tema velrybama je to skvely priklad. Nikdo nevi, jak to bylo, ale samozrejme jich bylo vice, jsou tak roztomiloucke a miloucke a takove sametove nadherne….. Treba velke krakatice se nechrani, pritom je videla zive teprve pred nekolika tydny a tedy jsou vzacnejsi nez vorvan….. Mozna by se vorvani meli vybit, nebot je zerou….. Znam zastance krakatic a i zastance velryb, ti kdyby mohli rozhodovat 😀

  182. DVD – než se do toho začala montovat EU se Schengenem a rušením hranic, tak ta hranice byla babybeef – dokud tele pilo jen mléko a nepřešlo na objemná krmiva – bylo to telecí.
    Mladé hovězí bych odhadl od babybeefu tak do stáří dvou let, tedy u jalovic do prvního otelení, u býčků tak někam podobně, tak do 500 -55O kg. ž.v., kterou by ten bejk měl dosáhnout nejpozději do dvou let věku(v závislosti na plemeni – masná dříve, kombinovaná později.
    Maso z krávy po pátém teleti už rozhodně není mladé hovězí. 🙂

  183. No jo, ale mas to srdce delat mlecnej vykrm? Vis kolik mame poptavek po takhle vykrmenejch jehnatech a telatech? To by chteli vsichni. Ale mas to srdce to delat? U nas pres tohle nejede vlak, je to jako vrazdeni nevinatek….

  184. Jirko, myslíš naše standardní dilema kavárenského ochránce přírody – Zabij bobra, zachráníš strom ?
    Ale uznávám, že jsem to blbou formulací yěch „původních stavů“ zavedl trochu na scestí, za což se vám všem co nejsrdečněji omlouvám.

  185. A pro Matzurku ještě jeden ftípek, vypůjčený od Plíhala:
    Přípitek genetiků: „Až do DNA !“

  186. Pane Tucnaku, na scesti…. Svedl….. To nikdy, ja jsem na scesti a svedenej furt. Nekdy jsou chvile, kdy mne nikdo nesvadi, tak se svadim sam… 😀

  187. Dobrý podvečer,

    k tomu ptačímu křížení :

    http://www.youtube.com/watch?v=tMXomsURNTc

    No a jinak jsem se vydaly s dcerou na nákupy doplnit prádelník. A nakonec jsme k prádlu koupily i šaty, protože bylly ve slevě a prý „mami, černý šaty stejně mít musím, malý černý, to je základ šatníku“.
    Pravila naše mladá, která dosud odmítala nosit sukni a když tričko, tak pokud možno nejodranější.

    A cestou zpátky volal synek, zrovna jsme stáli v metru a bylo blbě rozumět, něco o tom, kde jsem včera zaparkovala ( vůbec jsem včera autem nejela a hrklo ve mně, co že se stalo) a zrovna před vjezdem do tunelu a ztrátou signálu jsem najednou na třetí pokud rozuměla přesně : “ nemůžu najít koště, tak se ptám, kdes ho včera zaparkovala, když jsi přilítla z práce“

    Ale bylo to příjemné odpoledne, i když jsme utratily hříšné peníze a doma jsme ještě vytáhly ze schránky obálku s instrukcemi o tanečních ( další hříšné peníze).

  188. Když vyrábíš více mléka než máš kvoty, máš natalitu 110 (ks telet/100 krav) úhyny do 5% a zatížení skotem 1,2 VDJ/ha, tak proč ne?
    Zhodnotíš mléko, zlikviduješ bejky, ušetříš objemná krmiva…
    A když chceš vídeňský řízek, jiná cesta (kromě D1) k němu nevede… 🙂 😀

  189. Jo, a PS.
    První chovatelská poučka říká: Sentiment do chovu nepatří! 😉

  190. MaYdo, skoč k zrcadlu a zvaž jak vypadáš a jak se cítíš…!! 😀 😀 😀

  191. Šumaváku,
    třicetiletým výzkumem jsem zjistil, že vlak jede jenapouze přes to, přes co chce ŽD, aby jel.
    Chilli – dovolím si aproximovat na hospodaření našeho dottore: Pokud jeho ŽD nechce, tak nelze ani mléčná jehňata, ani telátka.

  192. No ja vim, ze sentiment blablabla, ale ty jehnata vidim skoro porad, je mi to proste trapne. Ale asi k tomu jednou asi dojde.
    Rizky jsou dobre to jo, a i prepustene maslo pri runych teplotach probihaj v nasi kuchyni casto, ale teleci si kupuju od statecnejsich, jsem srab. A mimo to, jatka jeste nemame okolaudovane. Kdyby byly, asi bych mel vice argumentu k telecim porazkam.
    Ale jinak mas pravdu s tema kvotama a mlikem.

  193. maYdo,
    🙂 no… vypadá to, že se mladej začíná docela slušně orientovat ve světě. Měla bys z něj mít radost 😀 😀 😀

  194. ad 221
    svatá pravda šumaváku!
    Jinak bysme z těch našich parchantů vychovali nevychovaný parchanti…

  195. Šumaváku,

    já vím, jak na tom jsem i bez zrcadla, ale syn má být k matce uctiv a nemá co naznačovat…. 😀

  196. A jinak, pánové, a zcela vážně, já z něj mám radost. On je takový vtípek u autisty, byť lehkého, něco jako první krok u chromého.

  197. Já nemluvil o synovi, ale o tom, že dcera usoudila, že bude potřebovat černé šaty.
    Mě by to teda znervoznilo…. 😉

  198. Mimochodem , jsou zmeny pri hlaseni telat a ovci…. asi i u ostatnich hospodarskych zvirat. To kvuli tem evidencim a tak. Jak je to u koni? Taky je to zmenene?

  199. My jsme sveho casu hlasili vsechno bez rozdilu.. . .stacilo jmeno a prijmeni, oni si to kluci na oddeleni uz vytridili.

  200. Nestačilo. Ještě to potřebovalo jméno matky otce za svobodna… 😉

  201. Tak to jsem se od srdce Brouku zasmál. A že mi moc do smíchu není…

  202. Šumaváku, na pohřeb je to poměrně nevhodný model. A dnes se chodí v černém víc do do společnosti než na funus.

  203. maYdo, no právě – kdo ví, koho tam potká … chce potkat …. 🙂

  204. Brouku 😀

    MaYdo, fakt si myslis, ze jde o saty? Ja si naopak myslim, ze pokud premejsli tak jak ma, tak touzi po pivu, nebo se ji zachtelo trosku te „Afriky“…. Voni ti pigmejove fakt nejsou zadni cahouni 😀

  205. JInak, Šumavákju, myslím, že odpvěď na otázku, jak se cítím, je danná právě tím, že mi ty to, co napadlo Tebe, vůbec nedošlo 🙂

  206. Tož, Jiří, výšku by na toho pigmeje měla akorát, ale myslím, že jí fakt šlo o ty šaty.

  207. Ptakopysku, myslim, ze saty nic neznamenaji ze si dcera mysli na funus. Kdyby to bylo na obrad, tak by zacala shanet i papirove boty prislusne velikosti a dbala na to, aby ten kdo vypada v rodine nejhure spal omyty a v pripazeni 😀

  208. A ještě s mincí pro převozníka pod jazykem, Jiří.

  209. Se musim omluvit. Samozrejme ze jmeno a prijmeni nestacilo, muselo se napsat co dotycna(ny) udelala. Napr. „Sledovala zed de ef“. . To se poznalo tak, ze kdyz jste se vecer pistavili pred panelak, tak jejich televize blikala uplne jinak nez nas ostatnich .
    Pak uz stacilo odpocitat okna poschodi a jit si to opsat na zvonky. . .kolikrat se clovek vratil domu jako rampouch….nebyla to lehka sluzba, a moc se taky neplatilo. . .

  210. Vyjádření V.Klause:

    ..Co říkáte na výroky ministra zahraničí ČR Karla Schwarzenberga, o Benešových dekretech, například, že jsou již zrušené?

    Že si něco takového pan Schwarzenberg dlouhodobě myslí, vím už dávno. Že si s tímto svým názorem dovolí vystoupit ve volební kampani na českého prezidenta, jsem nečekal. Asi byl zvyklý, že mu vždy všechno prošlo, ale já mu tento výrok prominout nikdy nemohu. Právě jsem se vrátil ze setkání tří prezidentů v Polsku. Jak v Polsku, tak na Slovensku jsou takové výroky a názory vnímány jako něco naprosto nepochopitelného…
    http://www.novinky.cz/domaci/290743-klaus-ke-schwarzenbergovym-vyrokum-o-benesovych-dekretech-to-mu-nemohu-nikdy-prominout.html

  211. Rputi, mam jeden dotaz…. CO JE HORSI…… Jestli zdaneni a vyhaneni tech co jeste neco delaji, vychovavani celech „uzemi“ kde se nemusi pracovat, likvidace podnikani, pro ty co mohou odejit…. A mnoho dalsiho, nez nesouhlas s dekretama? Ja tedy se klidne priznam, taky si myslim, ze vetsina Benesovejch dekretu je svinstvo a co jako…..

  212. Jiřiku, ti lidé, kterým vyletělo pár příbuzných komínem byli holt jiného názoru.
    A jistě víš, že odsunu Němců předcházel odsun českého, zajisté též pracovitého, obyvatelstva ze zabraných Sudet.
    A zajisté je ti známo, že německé obyvatelstvo bylo z Čech, Slovenska a Polska odsunuto na základě dohody vítězných mocností.

  213. >> brouk
    V NDR proběhla (60. léta?) akce, kdy ve škole nechávali děti nakreslit televizi s časomírou na obrazovce. Ta byla tenkrát digitální a na každé straně hranice jiná – jedny hodiny byly kulaté, druhé byly do čtverce. A hned orgánové věděli kdo kouká na nesprávnou TV.

  214. Matzurko, jeden dotaz…. Samozrejme ze nejapny…. Jak vidis emericke serialy, co jsou z Majami, co nejake jine lokality, kdy z nalezeneho vlasu, odbarveneho se behem pikosekundy odstraneni nejen barva, ale slicnou vjedkyni v prosklene laboratori extrahuje DNA a za dalsi velmi kratky cas, v podstate nez prijedou pred budovy novinari, prijde na to komu DNA patri a ze to vrah neni, protoze v te dobe byl na
    Etadlove lodi, ale ze ma brachu, co je desnej svinjak, ze ten vlas tam pohodil, protoze to odbarveni nebylo odbarveni, ale talek z rukavic ktere mel oblecene, kdyz bral vlasy z hrebene…..Neco jako ja na Malou farmu?

    Hele to s tou amnestii, to je akt neco nechutnyho….. Opravdu neskutecne hnusne a typicky ceske…..:-((((((((

  215. Na National geographic jde dokument k tématu článku, i když tedy redukován jenom na lidi.

  216. Rputi…. Jen tak na okraj, taky mame v rodine ti co proletli kominem a i byli vyhnani ze „sudet“ a tak mohu mluvit celkem ze sve , zprostredkovane, zkusenosti a hlavne, jako primej, nedobrovolnej ucastnik tech dekretu. Jak jsem jiz vcera psal.
    A hlavne , je mi to uplne sumak, jak se s tim vyporada stat, ja mam samozrejme jasno, protoze zrovna tohle tema bylo u nas u nedelnich obedu pomerne dost caste, protoze babicka, dedecek…. A tak.
    Mimochodem, kdyz jedu smerem na Moravu, po ruznejch cestach vetsinou se „potkam“ s tim, co rodine „po generace“ a pak prisel napred Masaryk se svou pozemkovou reformou…. Pak Hitler ….. Pak Benes….. Pak Klement…… No spis uz je to takova tradice, jeste ze uz v podstate neni co ukrast.

  217. Mno svinstvo. Ono se to lehce řekne. Ale zkus si představit, jak by se asi situace vyvíjela, kdyby k odsunu Němců nedošlo.

    Nemyslíš si doufám, že by se tak nějak ti vyhnaní v roce 1938 vrátili zpět do pohraničí, Němci tam žijící by jim ukázněně uvolnili jejich bývalé domy, vrátili nábytek, peřiny, slepice, dobytek atd. Do toho by se vrátil z Osvětimi sklenář Horáček, pověsil by pruhované hadry do skříně a začal by zasklívat okna. Jeho soused SS Sturmbanfuhrer Stetke by se také vrátil z fronty, pověsil by černou uniformu do skříně a jako předválečný truhlář by začal zase vyrábět nábytek a rámy na okna.
    Kapitán letectva Macháček by se vrátil z Londýna, otevřel znovu svou zámečnickou dílnu ve které by zaměstnal svého bývalého mistra Krusmanna, sestřeleného pilota Luftwaffe, který se vrátil ze zajateckého tábora v Benghází do kterého se dostal, když byl sestřelen nad Afrikou.
    A takhle v pátek na večer by se všichni ti lidé svorně sešli v hrubé hospodě, popili, zazpívali si, vyprávěli si veselé historky z války a vzpomínali na mrtvé kamarády a příbuzné. To všechno tak někdy v srpnu 1945.

    To by fakt nefungovalo, věř tomu.

  218. Matzurko, když to JIrka nakousl, taky by mně zajímalo porovnání těch kriminálek a reality.

    jiří, co je s tou amnestií hnusné?
    Namlelo se toho kolem tolik, že to sdělení je naprosto nevypovídající.

  219. 250 JIřiku, to tak v širších rodinách bývalo – někdo vyletěl komínem a jinej zas schytal malý či velký dekret – ke chlubení to rozhodně není.

    Jinak mám z tvé 250 pocit, že Schw. je proti vám chalupník … 🙂

  220. Samozrejme Pavle ze to nefunguje, popisujes to naprosto presne. Jn mas tam takovej renonc. Sklenar Horacekmse nemel kam vratit, protoze uz v tom byte bydlel nekdo jinej, nebot se nikdo nedomnival, ze se vrati a zlato a nabytek, ktere si schoval u druheho souseda nedostal nazpet, protoze soused vsechno zaprel. Stejne se vedlo tem co se vraceli z vnitrozemi na sve do sudet. A to meli kliku, kdyz vubec nasli dum prazdnej, protoze naplavy se rozlejzali daleko rychleji.

    Samozrejme, ze nejde nic srovnavat a svinstvo je samozrejme na strane tech co si zacali. Ale , furt je tam to ale…… Jak rikal Churchil, v case vitezstvi, nesmi chybet vitezum velkorysost….. Nebo tak nejak. Vzdy je to otazkou miry a sebevedomi. Na druhou stranu, celej povalecnej vyvoj byl zcela v intencich nastupu komunistu….

  221. Ty jo, ze ja vubec o necem zacinam….. Pojdme zaspivame si….. Prsi prsi jen se leje 🙁

    Netusil jsem ze jsou temata, ktera jsou zakazana. Pridam si ho tedy k tem, o kterych se nesmi, snad jen pod trestem smrti.

  222. 250 Jirko, já bych se k tomu nevyjádřil raději jinak, než slovy česko-německé deklarace z roku 1997.
    Ad ztráta majetku: Z větší rodiny byli po válce šťastní ti, kteří přežili.

  223. Jirko, co je s tou amnestií? Co mě čeká a nemine? Vaši „drobní“ zloději byli amnestováni a nahlíží se na ně jako na netrestané?

  224. Jirko ppa, vítězové byli velkorysí!
    Vyhověli těm co mocí mermo chtěli „Heim ins Reich“.Také byla možnost je internovat, postavit před válečný soud a postřílet, jak do té doby bylo v kraji zvykem.

  225. Nickname, to jsem nemyslel, tou „amnestii“ jsem myslel to co se dneska proflaklo…. Tedy kdo ji vytvarel a vubec se mi to nelibi a to nejen proto, ze Kocour a tak….

  226. Inu Jirko, zakázaná snad zrovna ne, ale ve slušné společnosti se holt nepšouká.
    Malý a Velký dekret, byly za spolupráci a udávání stejně jako spolupráce s STB o nějaký ten rok později.
    Samozřejmě, nikdo za nic nemohl a všichni tam byli omylem.
    Konec konců Lída Baarová taky tvrdila, že nikdy nekolaborovala.

    Nějak se mi začíná zvedat kufr…

  227. no jeste ze jsem mel vcera 39,5 a nemel chut cist
    dnes uz je to lepsi – tedy s tou teplotou. 🙁

    matzurko poctu si az budu vic vnimat.

    jinak jsem dnes videl knizete z ostravy , ze jede do olomouce. No byl zadychanej ze kdyz tak bude pokracovat tak bude pristi tyden jen jeden kandidat.

    klaus mladsi – nechapu , udelal blbost a musi vni rypat at je to citit vic a vic?

  228. Aha, tak jo, netusil jsem v jak dobre spolecnosti jsem…. Nezlobte se tedy, opravdu se omlouvam za to pohorseni a pocity zvraceni, co jsem vam zpusobil…….

  229. pasáčku, nebyli jsme ani u Němců, ani u STB – pokud vás zajímá tohle 🙂

  230. Jirko ppa,
    ad 255 – ale vítězům nechyběla velkorysost. Kdyby jim chyběla, všichni Němci by místo odsunu vyletěli komínem. Přesně podle vzoru, který oni sami předestřeli. A bylo by po problémech…

  231. ne nezajima mne to zda jste koukala na ty okna jak blika TV.
    je mi to jedno a byla to jen recnicka otazka.
    ti co byli to stejne nereknou

  232. Hle,
    Šumavák mě předběhl. Akorát že je zbytečně humanitární.
    To je tak, když člověk nedočítá. Vracím se raději zpátky k rozpitému Saviňonu, nějak přituhuje…

  233. ptskopysku 267 to byla na viteze slozita operace.
    na to nemel lidi a pracovni postupy. technologii by opravil po osvobozovani.

  234. Jirko, pokud budeme tedy počítat ČR k vítězům 2.sv. války, velkorysost nechyběla. ČR dostala zpět své původní území, nečinila si žádné nároky na další německé území (na rozdíl třeba od Ruska, které si vynutilo posunutí Polska směrem na západ) a přijala bez nějakých zásadních sankcí zpět Slováky kteří byli na straně poražených (Slovenský štát). Dokonce velkoryse zanechala Rusku Zakarpatskou Ukrajinu.

    Vůči vlastním obyvatelům (v Sudetech) se zachovala rovněž velkoryse a umožnila jim odsun do Německa, kam vlastně původně chtěli. Technicky vzato se tito obyvatelé dopustili vlastizrady a mohli být v naprostém souladu se zákonem popraveni.
    Kdyby vláda/Beneš nebyli velkorysí, musela by ČSR řešit jednak obrovské množství oficiálních trestů smrti a za druhé se vypořádat se skutečně mnoha případy násilí vůči skupině obyvatel ze strany Čechů/Slováků vůči Němcům/Maďarům. V některých oblastech by to možná připomínalo spíš občanskou válku.

    Nehodlám nijak omlouvat hrůzy a excesy vůči Němcům, které se děly při divokých odsunech. Jejich viníci měli být postaveni před soud a odsouzeni. Že nebyli, je smutná kapitola a důvod pro omluvu za tyto konkrétní činy.

    Ale celkově vzato bych si dovolil trvat na tom, že odsun Němců jako takový bylo řešení VELMI velkorysé, VELMI moudré a VELMI laskavé.

  235. 271 pavle povetsinou souhlas .
    jenom bych pouzil slova z historie.cz co jsem tam slysel – ona zminovana suverenita malych statu vlastne nikdy neexistovala

  236. No a ještě takový malý soukromý postřeh k oblíbenému argumentu, že se s odsunem bohužel svezla řada nevinných Němců. Už jsem to možná psal kdysi na Psu, ale neuškodí si to zopakovat.

    Moje rodina koupila před cca. 35 lety chalupu v Sudetech. Koupila jí od české rodiny, která jí koupila od jiné české rodiny atd. Nicméně majitelkou té chalupy na konci války byla Němka, svobodná učitelka ze základní školy, která byla dle Benešových dekretů odsunuta. V podstatě nevinná obět odsunu.
    Jenže co čert nechtěl, naše rodina na té chalupě jako první dělala pořádnou rekonstrukci. No a v průběhu té rekonstrukce jsme tam našli pár zajímavých věcí. Například za prkny uschovanou dýku SS a dvě uniformy SS.

    Po roce 1990 se párkrát stalo, že přijela rodinka v autě s německou značkou a začali si chalupu fotit. A když jsem se s nima dal do řeči, tak říkali, že si fotí místo kde bydlela jejich babička. Tak jsem tu uniformu vytáhnul ze skříně a zeptal jsem se jich, jestli si chtějí odvézt ty šaty po dědečkovi. Najednou se měli rychle k odchodu…

  237. Tak jo, uz se nechci o tom zminovat. V podstate jste mi vysvetlili, ze to jinak nebylo mozne a ze se Benes a spol zachovali velkoryse. Jen jestli jste dobre pochopili to, co jsem psal na zacatku….. V prispevku 245, jsem v zadnem pripade nezminoval ani sudetske nemce, ani odsun, ci cokoliv co by melo byt spojeno s touto tematikou. Psal o nekterejch benesovejch dekretech. Jak je videt, tak si vetsina populace a vy take, spojuje benesovi dekrety pouze s otazkou odsunuti nemcu, o kterem jsem mimochodem nize psal, jako o logickem aktu po valce, kdyz meli prijit komuniste k moci, tedy oni uz vladli, jen si to nechavali pro sebe.
    Takze se pojdme, aby nekdo nemusel odbihat na zachod zvracet, se vratit k tomu puvodnimu co jsem myslel a o cem jsem psal. Tedy bylo spravne to znarodneni a v podstate jeste vetsim rozsahu, nez v tom 48? Ja si myslim, ze ne. A nema ro nic spolecneho s nemcema.

  238. no jo ono kdyz ta baarova kolaborovala , rozhodovali casto „partizani posledniho mesice “ , skupiny ktere jiz v te dobe byly pod vlivem ruskych tajnych sluzeb.

    ne nechci otvirat nic z minulosti – jenom mne prekvapuje ta lehkost odsouzeni .

  239. kdyz tak premejslim tad deda ktery kulacil byl kolaborant s komunistama
    vzdyt porad odvadel deputaty az do te doby nez o vsechno prisel.

  240. 275 Jirko, čtenáři rakušanů ví, že znárodňování je hloupost. Co více k tomu dodat.
    V podstatě všechny náhlé změny poměrů (obnovené zřízení zemské, husitské počínání, světové války) jsou hloupost.

    V ČT běží seriál „zašlapané projekty“, kam bychom to dotáhli, kdyby soudruzi uměli lépe plánovat. Chtělo by se říci, kdyby se soudruzi rozhodli se do toho nevrtat.

    http://www.ceskatelevize.cz/porady/10209988352-zaslapane-projekty/409235100061016-kombajn-pro-muzeum/

  241. 100/1945 Sb. Dekret prezidenta o znárodnění dolů a některých průmyslových podniků
    101/1945 Sb. Dekret prezidenta o znárodnění některých podniků průmyslu potravinářského
    102/1945 Sb. Dekret prezidenta o znárodnění akciových bank
    103/1945 Sb. Dekret prezidenta o znárodnění soukromých pojišťoven

  242. pavle – strach o majetek ktery vyvolava otevreni benesenovych dekretu je mozny jenom diky tomu ze se vedeni kotliny NIKDY neumelo o bezpecnost tohoto soukromeho majetku postarat.

    a k tem nemcum – no myslim ze spousta z nich je vychovavana s prizmatem druhe svetove valky . No hrdi by na tu uniformu urcite nebyli – jde o to zda to je odsuzuje k hanbe?

  243. „Sledovala zed de ef”. . To se poznalo tak, ze kdyz jste se vecer pistavili pred panelak, tak jejich televize blikala uplne jinak nez nas ostatnich“

    Tak to se v Chebu stát nemohlo, tam blikala všem stejně:) S výjimkou kasáren, asi.

    Jinak k 261 musím podotknout, že ten frajer, co udával členy Rady Tří budoval po válce SNB a žádnej dekret nedostal, leda na barák po židech.

    Jo kdyby to všechno bylo tak jednoduchý.

    Jako osoba „blízká“ koncentráčníkům a padlejm, navíc ze Sudet musím říci, že bych skutečně dala před provedeným odsunem přednost principu potrestání viníků, nikoliv kolektivní vině. Však ty bývalé Sudety také mohli obsadit Amíci, jako eneser…ovšem to by Maskva a Dohoda nedopustila, že?

    A Beneš po odsunu Němců toužil už před válkou, co si budeme namlouvat.

  244. Jirko, tak to si asi nerozumíme. Já mám problém skutečně jen s tou částí BD která se týká odsunu Němců a obecně věcí kolem 2.sv. války.

    Znárodňování je svinstvo ať už dekretem nebo bez něj. Opět, pokud se to netýkalo Němců po 2.sv. válce.

  245. Dobrý večer vespolek,
    dovolím si odpovědět na pár dotazů, odpoledne jsem si zaskočila pro šafrán a trochu toho zázvoru, neb cesty už sjízdné a rodina hladová 🙂
    Zase po pořadě, aby se v tom šlo vyznat.

  246. Tučňáku,
    ad gepardi, ano, údaj jsi uvedl správně, a ten časový odhad byl udělán právě na základě matematického modelu. Ten nám totiž může říci, na základě genetické variability a velikosti současné populace, jak velký ten pokles byl a kdy asi nastal…. Ale samozřejmě to není tak, že bych do kompu naládovala data a vypadla odpověď, ten model se musí ověřovat randomizací, a je pořád na příslušném vědci, jaké nastaví počáteční parametry (tedy hodnoty, které odhaduje na základě dalších, negenetických studií – biologie a ekologie zkoumaného druhu, případně záznamy historicko-paleontologické). A když to nějak neštymuje, nastaví parametry jinak, a zase randomizuje…..až se trefí, jásá, publikuje.
    Datování “nového” druhu je spíše záležitostí paleontologů, a tam jak známo, plus mínus jedna cihla zvíci milionů není problém. Ta hranice je skutečně rozplizlá, nové druhy sebou nesou variabilitu druhů, z nichž se vyevolvily – a právě to umožňuje se pak v genetické informaci orientovat proti proudu času.
    Takto, máme druh D1 (s bazí T) a druh D2 (místo T má na témže místě bázi G). Takže dané místo je druhově specifické, a pokud nás zajímá, kdy tato mutace vznikla. Přibereme tedy třetí druh D3, a němž paleontologové prozradili, že se vyvinul dříve , ale nevyhynul, takže můžeme vzorkovat. A ejhle, na daném místě má bázi T. Takže druh D1 si ji přinesl od společného předka, je to tedy “původní” stav, zatímco D2 nově zmutoval. Samozřejmě, jsou i jiné možnosti (třeba že mutace vznikla u D1 a D3 a původní je G), ale vždy se bere nejjednodušší možné vysvětlení, pokud nenastanou další okolnosti svědčící pro něco jiného.

  247. jen tak jdu kolem pro další lahvinku,
    Baarová pokud vím, kolaborovala i s Hugo Haasem, ne? Koneckonců, Haas to byl velkej kolaborant! Kolem něj prošla pěkná ženská a už byl ochoten kolaborovat…

  248. Františku,
    ad 193, plemenitba je zcela jistě řízená, a „špatné“ kusy končí v salámech… aspoň myslím, k tomu by se lépe vyjádřil Šumavák. Nicméně u mnohých psích plemen se to negativně projevuje – takže ti superčistí s nejdelšími rodokmeny mají mnohem více zdravotních potíží (to by zas asi doplnila westík), mnohdy pramenících z nějakého znaku dohnaného uměle ad absurdum (např. problémy s páteří u bassetů).
    Mitchela jsem nečetla, ale navštívila jsem Yucatánský poloostrov, zejména mayské památky. Na stélách a jiných vyobrazeních mi vladaři extra krásní nepřišli, od těch porobených válečníků se lišili leda tím, že seděli někde výše a nekrváceli z otrhaných nehtových lůžek. Pravda, krváceli třeba z jazyka, neb na obětování bohům se v krizových siutacích hodila jen krev panovníka, ale to holt bylo riziko profese. Vyznačovali se dost šišatou hlavu (ale to bylo v důsledku bandážování od dětství), a špičatými zuby (v důsledku pilování). Možná tou „šiškou“ tu výšku chtěli nahnat – dnešní potomkové Mayů jsou docela prťaví (já se svým metrem šedesát jsem se cítila mezi svýma), a kolega, co tam pravidelně jezdil na stáže, je označil za „krpaté“, tedy s tak krátkým krkem, že hlava vypadá jakoby vražená mezi ramena. Což ale nesouvisí s příbuzenským křížením, ani nic nevypovídá o jejich povaze – jsou totiž velice příjemní a milí, aspoň na turisty ano 🙂
    Při tom příbuzenském křížení je ten projev brán opět na celou populaci, různí jedinci mohou (a taky nemusí) být postiženi různě, jako celek je ale populace méně životaschopná (evoluce pracuje na populacích prostřednictvím jedinců…). Podstatné je to, zda dotyčný jedinec zdědil nepříznivou mutaci od obou rodičů a projeví se tak v plné síle, či nikoliv. Takže skutečně může špatná mutace cestovat generacemi, až se nakonec u někoho projeví. To cestování bude tím delší, čím méně příbuznosti mezi jedinci bude… a naopak. Nicméně během evoluce vznikly i druhy tomuto přizpůsobené, takže se dále množí samooplozováním – dost časté v říši květin, ale i u živočichů se případy najdou.

  249. Tak koukam, ze benesovi dekrety jiz nebudi takove vasne, jako pred hodinou. Coz jsem rad. Treba by i pan prezident mel nechat tu svou dvouminutovku nenavisti a trosku si popovidal s autorem vyroku, co tim vlastne myslel…. Ale chapu, vseholid si zada a tak to dostane….

    Andy, nevim kdo udaval a kdo pak budoval….. Nebo si nevybavuju, kdo by to mel byt. Nechci guglovat

  250. Jirko a MaYdo,
    ad CSI a jiné. Mno, ze začátku jsem je napjatě sledovala, přeci jen bylo hezké vidět sympatického herce ve stejných rukavicích, jaké nosím v laborce já, ba i stejné vybavení té laborky… ale když už potřetí šéf na místě činu blekotá svému týmu, že si mají vzít ty rukavice, a oni odpoví, že aby nekontaminovali biologické stopy, tak jsem toho nechala.
    Nojo, jsou to případy… ano, Malá Farma asi bude vhodný ekvivalent, i když nejsem ani kriminalista, ani divák Malé Farmy, ale indicie tak nasvědčují. Ještě tak slušní mi přišli Sběratelé kostí (hlavní hrdinka antropoložka a la Sheldon Cooper, okolo neuvěřitelný tým expertů – tam ještě občas nakouknu, neboť jsem zvědavá, koho zas odkrouhli a jak, a chemik/pyrotechnik/forenzní biolog/ Hodgins je IMHO boží).
    Co se týká rychlosti analýz, záleží na odebraném materiálu, jeho množství a kvalitě. V zásadě se dá extrakce DNA zvládnout za hodinu, PCR proces za další dvě, a sekvenování za dalších šest…. s technickými prostoji bych to „dala“ do dvaceti čtyř hodin, pokud všechno funguje dle předpokladů a nenastanou neobvyklosti. Ve skutečnosti se ale třeba sekvenátor obvykle spouští, až když je zaplněná celá sada ve vzorkovnici (8 až 96 zkumavek), a i když už jsou třeba profily udělané, následuje statistické vyhodnocování a pak teprve s určitou pravděpodobností potvrzení nebo vyloučení podezřelého.
    Kolega, který chvíli pro kriminálku pracoval a potvrdil, že z nedopalku cigarety nebo kelímku od piva DNA extrahuje a profil uživatelé zjistí.

  251. Rputi,
    tak to mi s tím Tutanchamonem kolega vypálil rybník, přesně tento článek jsem chtěla pro zdejší blog zpracovat… nevadí, okořením to více podrobnostmi 🙂
    Má pravdu v tom, že se o tom teď budou lidi dohadovat dlouho, on dr. Hawas byl tak trochu žárlivý na své teritorium a pyšný na spolupráci s National Geographicem a BBC dokumenty – tam se vždy objevoval hlavně on (ale práci dělal celý tým) a v klobouku a la Indiana Jones 🙂

  252. to máš jedno, jirko, dneska už je to skutečně pasé, všichni jsou na pravdě bóží.

  253. Kristo,
    záleží na tom, zda zachráněné „nedochůdčátko“ bude schopno zplodit potomky, a zda budou také postižení…. přiznám se, tuhle část klinické genetiky nemám nastudovanou, ale vzhledem k lidskému/etickému rozměru (jsou rodiče, kteří si přejí dítě zachránit za každou cenu) se tomu asi nikdo moc nevěnuje (taky to „smrdí“ eugenikou, a to už je vůbec tabu).

  254. matzurko takze polucii mne vlastne prozradi sliny ktere jsem nekde nechal ( pokud vynechame ty jasnejsi dukazy DNA co zjistuji UV svetlem 🙂 )
    musim si davat pozor at pri vrazde nikde moc neslintam .
    jo jeste bych nemel pelichat.

  255. Jirko, já tedy neumím německy a nečtu německý tisk, takže si nemohu ověřit zda německá a rakouská média píší to, co idnes tvrdí, že píší:

    http://zpravy.idnes.cz/klaus-odsoudil-vyroky-schwarzenberga-o-dekretech-nemci-knizete-chvali-1m6-/domaci.aspx?c=A130119_184733_domaci_brd

    Nicméně pokud tomu tak je, tak ani Klaus, ani Němci ani Rakušané nechápali tu Schwarzenbergovu zmínku o dekretech ve smyslu znárodnění bank, dolů či podniků potravinářského průmyslu, ale výhradně ve smyslu o kterém jsem psal. Tedy výhradně ve smyslu odsunu Němců ze Sudet.

  256. Pepo,
    ovšem smůla je pokud kelímek odhodíte na místě, kde potom někdo spáchá trestný čin. Můžete být piánko v okruhu podezřelých…tak bacha na dobré alibi !
    Ano, při páchání trestné činy nepelichat, neslintat, nedrbat si ekzémy (i šupinka kůže prozradí, bacha na škrábající oběť, bude mít vaši kůži pod nehtama), nic nevylučovat a nevyměšovat….
    Jelikož choříte, zkuste si pustit film Gattaca, bude se vám (doufám) líbit. Není to detektivka, ale docela chytré sci-fi 🙂 s DNA v podstatné roli.

  257. matzurko zkusim najit 🙂
    a hlavne se budu snazit nebyt nikde kde se pak bude vrazdit. Lidi lehce odsuzuji , urady uplne stejne.

  258. Mimochodem, když si vezmeme inkriminovaný výrok:

    „Já jsem vždy říkal a na tom trvám, že to, co jsme v roce 1945 spáchali, by dnes bylo odsouzeno jako hrubé porušení lidských práv. Asi by se tehdejší vláda včetně prezidenta (Edvarda) Beneše ocitla v Haagu,“

    tak si myslím, že ani Schwarzenberg neměl na mysli znárodnění dolů nebo podniků potravinářského průmyslu. Doly, banky a další podniky znárodňuje a opětně privatisuje v EU kde kdo, naposledy Anglie, Francie a Belgie a před trestní soud v Haagu se za to nechodí. A Schwarzenberg to jistě ví, je to chytrý chlapec a ministr věcí zahraničních. A taky ví, že před trestní soud v Haagu se chodí za zločiny genocidy apod.

  259. koukám, že se knížeti pěkně povedlo rozjitřit vášně
    jako by nebylo tolik let po válce
    a jako by nestačilo, že koncentráky jsou v čt minimálně dvakrát denně

  260. Pepo, copak nebýt a nevraždit. Ale hlavně neblikat !

  261. Pavle, no jooo, to jsem necetl. Beru tedy poznamku o panu prezidentovi zpet.

  262. Tedy vy máte téma. Škoda, že Hrabal v Obsluhoval jsem angl. krále pominul odsun tchána. Jestli po válce potrestat viníky nebo aplikovat kolektivní vinu, na to je dnes trochu pozdě. Ti němečtí hoši, kteří se rozhodli vrátit, už tu už dávno nemovitosti koupili. Tady ovšem jde o fin. vyrovnání, proti kterému jsou církevní restituce koruna na zmrzlinu. A s tím by si kníža neměl hrát ani ve srandě, i když on by na tom asi vydělal.
    Rputi, Kocour s tím naneštěstí moc společného neměl. On, perfekcionista, by něco podobného z tlapiček nepropustil. Sranda, že se k amnestii nechce znát ani šéfka Klausova práv. odd. Až vše utichne, rád si s ním o tom pokecám.

  263. pasacku: to jeden nikdy neví. Před časem jsem viděl nějakou detektivku, kde si hlavní hrdina blbě hlídal svůj popelník s vajglama a následně byl obžalován z vraždy, protože někdo obsah jeho popelníku sebral a vysypal na místě, kde měl jako čekat až oběť přijede domů. A přesně, policajti sebrali vajgly, udělali test na DNA, sebrali vzorky v domácnosti oběti (vlasy, sliny, šupinky kůže) a opět testy DNA a už se vezl…

    A jedině hrdinný detektiv ve spolupráci se sličnou obhájkyní přes odpor nadřízených dokázal, že on nevraždil, že byl jen milencem oběti a vraždil manžel. Nebo byl jen manžel oběti a vraždil milenec ? To už si nepamatuju…

  264. Pavle – nebudu diskutovat o zachrane nemcu odsunem.

    znovu se zeptam co delal benes a vsechny ostatni paternici z kotliny ze majetkove zmeny valkou zpusobene nepodchytil pri reparacich .

  265. Ja mam zkusenost s tim jak se v Rakousku odebira a zkouma DNA… A bez poznamek, ze se nam tam narodilo decko, ale vykradli nas a tak inspektor a detektiv nasel na miste cinu rukavice, moje. Ani nevadilo ze byly na lyze, ale oni rikali, ze musim dat DNA, ze jako zlodej je mohl pouzit na chmatani po nabytku. Tak jsem otevrel pusu a v laboratori my setreli slinu z patra. ….. No a pak vyloucili ze jsem si nevykradl byt, nebot v te dobe jsem byl uplne jinde. A zlodeje taky nechytili …. A rukavice taky nevratili a hlavne teprve po nekolika urgencich a jednom osklivem dopisu od pravnika jsem dostal potvrzeni o tom, ze jiz moje DNA neni v jejich databazi….

  266. pasacku – pokud vím (fakt se mi nechce teď hledat odkazy) tak ČSR nevyžadovala reparace právě proto, že si ponechala majetek odsunutých Němců. Za což byli později odsunutí sudetští Němci odškodněni v Německu, německou vládou.
    Takže lze zjednodušeně říct, že reparace proběhly. Němci tu zanechali majetek a tento zanechaný majetek jim nahradila později německá vláda, patrně z peněz německých daňových poplatníků.

  267. pavle – ano taky se mi nechce hledat ale jak to udelali ze by to slo ted zpochybnit?

    neco jako hele nic nam nedavejte a my zase nedame nic tem co jsme je odvezly.
    tady je ruka stejne tu budou rusi a vam se sem nebude chtit ?
    jde mi o toto – jak to nase pater zprocesovala ze se ted boji ze by mohla prohrat?

  268. v každém případě se proruské klace podařilo pana Schwarzenberga zatáhnout do špíny, jak bylo účelem.

    Je skoro neuvěřitelné, že na to někdo gramotný skočil.

  269. Jo a jedno OT …. V nedeli konci ve Veletrznim palaci Teodor Pistek. Kdyby nekdo mel cas a chut, at vyrazi, mnoho veci je opravdu fascinujicich…..

  270. Jinak tedy argument, že jakákoli vláda či president a nejen v ČSR byla odpovědná za to, že majetkové změny způsobené válkou se podchytí při reparacích je dost podivný.
    V průběhu 2.sv. války se postupně odehrály v celé Evropě takové majetkové přesuny, že IMHO nešlo vůbec po nikom chtít, aby je podchytil při reparacích. To jednoduše nebylo v lidských silách a nebylo možné to v dohledném časovém horizontu rozmotat.

    Namátkou příklad – bohatá židovská rodina byla během 2.sv. války vyvražděna. Její majetek byl zabrán Němci, dílem rozkraden (zlato, obrazy, šperky), dílem zůstal na místě (nemovitosti, pozemky). Po válce Němci odsunuti, zbytek majetku zabaven státem ČSR. Vzdálení příbuzní té židovské rodiny žijí v USA. Který stát, jak, kolik a vůči komu by měl započítat do reparací ? A měla by ČSR platit reparace například těm příbuzným v USA, když si tedy ponechala pozemky a nemovitosti ? Nebo by je mělo platit Německo ? Otázky, samé otázky…

  271. pasáčku – já nejsem právník, takže tohle moc rozmotat neumím. Pokud jsem to správně pochopil z médií od roku cca. 1990, tak obava je zhruba následující:

    Pokud ČR připustí neplatnost BD, stane se odsun sudetských Němců protiprávním aktem z hlediska mezinárodního práva. Pokud se stane protiprávním aktem, otevře se prostor pro potomky odsunutých Němců vznášet žaloby o restituce nemovitostí a náhradu škody vůči ČR (resp. vůči daňovým poplatníkům v ČR). A to i v případě, že Německá a Rakouská vláda se zřekne jakýchkoli nároků vůči ČR, protože takové rozhodnutí vlády nezbavuje občany těch zemí podávat individuální žaloby.

  272. pasáčku – Češi vůči Němcům by nemohli vznášet žaloby žádné. Nikdo žádné majetky o které by přišel v důsledku 2. sv. války na německé či rakouské straně hranic nemá. Snad až na nepatrné vyjímky.
    A kolektivních či individuálních nároků na jakékoli náhrady se vzdala ČSSR ústy svých komunistických zástupců někdy v 70. letech nebo kdy přesně. Nevím, jestli to bylo za Svobody nebo až za Husáka.

  273. ani ja tomu pavle nerozumim .
    ale pokud je strach ze mohou jen sutetsti nemci tak to ta druha strana mela asi lepe pripravene.
    ja si spise myslim ze tam bylo neco jako – k nam uz nikdy nikdo ze zapadu nebude moct – jsme soucasti velke vychodni rise. nebo mame prece platne dekrety tak se nam nic stat nemuze.

    zkusim se poptat meho spolecnika,az prijede, on jak zije v rakousku a zajimalo ho to tak se tim vic zaobiral

  274. A kolektivních či individuálních nároků na jakékoli náhrady se vzdala ČSSR ústy svých komunistických zástupců někdy v 70. letech nebo kdy přesně

    tak na jednu stranu tvrdis ze se vlady v reparacich nemohou vzdat naroku obcanu a nadruhou tvrdis ze za nas to vlada udelala a ze to plati.

    ale jo tak uvidime .
    kdyz to tak ctu tak o co vsechno se ma diky cirkvim a ted sudetakum prijit tak by musela byt CR asi dvakrat tak velka

  275. pasáčku – no problém je v tom, že německá ani rakouská a ani maďarská vláda to nikdy neudělala.

    Což je mimochodem věc, která mně na celém tom sporu zaráží nejvíc. Pokud jsou BD dávno vyhořelé, neplatné celkově nezajímavé a Německo a Rakousko to uznává a respektuje, tak přece dávno za těch 23 let (chápu, že něco takového nechtěly udělat za komančů) mohla německá i rakouská vláda vydat nějaké prohlášení, deklaraci, zákon (nebo jak se to musí jmenovat, aby to bylo závazné) o tom, že při případném zrušení BD ze strany ČR sama odškodní veškeré majetkové nároky vysídlených Němců, Rakušanů a/nebo jejich potomků které uzná soud německý, rakouský, český či mezinárodní.

    Pokud o nic nejde a nikdo žádné majetkové nároky vznášet nehodlá ať už s platnými BD nebo bez nich (jak Němci a Rakušané neustále tvrdí), tak by vlastně o nic nešlo a bylo by to jen hezké gesto, protože žádné žaloby by nebyly a nikdo by nic neplatil.

    Ale když oni se k tomu vydání nějaké takové deklarace pořád nemají. I když tvrdí, že o nic vlastně nejde. A to mně na tom mate 🙂

  276. Ovšem… kdo by se na to 24 hodin koukal a čekal na výsledky, že? Jsou filmy, kde přeskakují v klidu celá staletí a nikdo se tím netrápí… 🙂
    Umělecká licence? se tomu myslím říká. 🙂 🙂

  277. 2 dvd – ad 205 – No, to mi tak ňák evokuje otázku, kolik procent Němců má obsahovat typická německá obec? (slovo „typická“ budiž chápáno tak, že nad mapou Německa zavřu oči a náhodně píchnu prstem… A jest určeno…)

  278. nemam rad kdyz se hledaji chyby u druhych misto u sebe.

    pokud tedy lze „prohlasenim statu“ zrici se individualnim pozadavkum osob pak tu chybu udelaly nase vlady a ne ze nemci furt nic neprohlasuji.

    tak proste soucasne vlady se aspon snazi a tvrdi ze BD plati. Pokud nude knize prezident tak je asi sam zrusit nemuze – nebo jo?

  279. Tak ona je u nás ta otázka reparací a odškodnění ještě trochu komplikovaná protektorátem a Mnichovskou dohodou…

    No a posuzovat tehdejší události prizmatem stávajících zákonů a zvyklostí je velmi ošidné.Záleží na tom, kudy se do toho hranolu koukne.

  280. Pepo, to snad ne, ale může nezvratně uzavírat mezinárodní smlouvy. A nebude-li se cítit vázán čs. právním řádem, můžeme se dožít věcí…
    Riziko dnes nevidím ve vydávání konkrétních majetků sudetským Němcům ( i když sem každoročně v květnu jezdí a říkají“ starejte se nám o ten dům pořádně, Havel nám slíbil, že když bude prezidentem, dostaneme to zpět…“ 🙁 ) ale v tom, že mohou uspět u ESLP s žalobami na diskriminaci při vyrovnávání křivd (třeba ve vztahu k církevním „restitucím“).
    Dost pochybuji, že by Schw. trval na schválení té vyjímky z Listiny LP, kterou požadoval Klaus, o řešení podobných problémů podle čs práva… .
    Ten pokus udělali sudeťáci s Polskem. Neuspěli, protože Poláci opět sedli na koně, vytahli šavle a vyrazili proti tankům.A spolková vláda upozornila individuální žalobce, že je napřed čeká vracení a vyrovnání odškodnění, které dostali od SRN a pak nejistota, co jim Poláci vrátí. Nějak to utichlo a abych pravdu řekl, výsledek nevím. Myslím si ale, pokud by někomu Polsko něco vrátilo, nepřehlédli bychom to.
    U nás zůstává ten háček MD a protektorátu.

  281. 317- a proč by to jakákoliv německá vláda kdy dělala? Je to velká významná zem a neexistuje důvod, proč by se sama zbavovala něčeho, co třeba v budoucnosti může získat( nebo nemusí), když ji k tomu nikdo nenutí?

  282. sumavaku osidne to je vzdycky – ne nadarmo se rika ze po boji je kazdy general .

    dle mne stejne prezident zakon nezrusi a ze to knize rekl si myslim prohral volbu.

    mne jenom prekvapuje ze cela volba stoji jen na historii nebo dejepisu ?

  283. sumavaku 322 tim mi ale vic ukazujes ze ac si hrajeme na suverena – nikdy jsme jim nebyli.
    nebyli jsme jim ani u MD nebyli jsme jim ani v roce 45 nejsme jim ani ted.
    nevim zda to je tim ze je nas malo nebo ze nesedneme na kone jako polaci

  284. Tak ono by to s tím zrušením BD Mělo Německo celkem jednoduché. Pokud by prohlásilo Mnichovskou dohodu za neplatnou od samého počátku, ztratily by BD oporu a mohly (musely?)by být prohlášeny za neplatné.
    Jenže to by pak u nás nebyl protektorát, ale okupované území jako ve zbytku Evropy a celé by to s těmi reparacemi vypadalo jinak.
    Do toho se ovšem Němcům nějak nechce…

  285. No, mohou. Oni to i Francouzi i Angličané už udělali…

  286. Ale to by byl konec s mírem zajišťovaným EU v Evropě… 🙂

  287. Osobně se likvidace ČR pomocí Benešových dekretů, resp. jejich zrušení obávám méně než nájezdu kobylek…a vám doporučuji to samé.

    Dobrou noc.

  288. Šumaváku,
    v těch detektivkách už je ale skoro víc toho básnění, než licence 🙂
    Přiznám se, definitivně mne odradil díl, kde sličná kriminalistka měla co do činění z krví podezřelého nemocného AIDS. Když centrifugovala mikrozkumavku s jeho krví, prasknul skleněný stůl (?!?!) pod centrifugou (německé provenience, stejná jako ta s dříve plastovým, nyní ocelovým deklíkem jak jsem nedávno psala, viz http://www.eppendorf.com/int/index.php?pb=dec4d31b1b6a7bcd&action=products&contentid=1&catalognode=9879&productpage=1). Takže nejen že se centrifuga otevřela za běhu (asi měl ten skleněný stůl tajnou spojku na bezpečnostní uzávěr centrifugy i deklík), zkumavka vylétla, za letu se otevřela a odstřeďovaná krev (asi to dělalo kotrmelce, principem v té centrifuze je naopak sešoupnutí vzorku na dno zkumavky) stříkla do nechráněného (?!?, práce s infekčním materiálem je děsná sranda) oka dotyčné kriminalistky (která místo aby se zdekovala při první podezřelém zvuku, ono se to vrtí při 13tisíc rpm, na to čučela s otevřenou hubou).
    Tak jem to vypnula a už raději koukám na jen Poirota, Midsomerské vyvraždění a jiné věrohodné příběhy 🙂 (na UK kanálu ITV3 jich dávají dost).

  289. S krví, ježišmarjá, já už fakt blbnu !!!

  290. sumavaku proctu si to ale kdyz vezmu ze vlastne EU je pokracovani nacistickeho nemecka nejak v tom nechapu tu francii jak tem nemcum naletela. Zrovna jsem koukal na porad o alsasku.
    ale kdyz na vse pristoupi tak tu mame suverena nemenecko ( s celou EU) a rusko
    vsichni ostatni se bud pridali k suverenu nemecko nebo k suverenu rusko.

    no ac budu pesem az do smrti oznacovan za EUmila tak se ptam kde mame byt?

    sami sebou jsou pekne reci ale jen reci .
    suverenitu nemame ani vojensko ani ekonomickou snad tedy jeste politickou ( protoze to nemecko asi chce udelat mene tvrdou cestou jak za hitlera? )

    me nevadi byt soucasti EU ( radeji jak ruska)
    me vadi socialismus a byrokracie EU

    no jeste je ta moznost vyhlaseni valky USA a nechat se obsadit – mohli bychom byt zakladna obamy

  291. Matzurko, TV seriály a filmy nelze posuzovat z hlediska profesionála v tom kterém oboru.
    Já sám mám jen šest semestrů analytické chemie na PřFUK, obor jsem nikdy nepraktikoval, ale když se ve filmu děje cokoli laboratorního, cukají mi koutky nebo se dokonce nahlas chechtám.
    A pokud se tam vyskytuje něco s počítači nebo nedejbože dokonce s počítačovou sítí, tak málem lezu po zdi nebo vyskočím z kůže. Ještě, že se Hollywood vyhrabal z plenek let 80. a 90. a v moderních filmech už při fatálním kolapsu centrálního počítače nebo počítačové sítě nevybuchují monitory. To jsem ty filmy opravdu sledovat ani nemohl, protože jsem se smál až mi tekly slzy.

    Jo a vrcholem byl film Síť se Sandrou Bullock v hlavní roli. To, jak tam hledá zákeřný virus ve hře Wolfstein nebo jak urputně tracuje TCP/IP síť s adresama typu 435.18.269.338 a podobně. To jsem vysloveně viděl, jak odborný poradce pustil traceroute a ono to psalo:

    192.168.1.15
    192.168.1.1
    213.192.3.14
    82.36.5.18

    režisér na to kouknul a začal ječet „Hergot, za ty prachy co vám platíme tam musej běhat pořádný čísla, ne tyhle malý čudly…“

    🙂

  292. Mimochodem, mám známého, který je absolvent MFF UK a skutečně pracuje jako matematik. Takový ten klasický matematik, co si vystačí s tužkou, blokem a vrcholem jeho ročního bádání je to, že něco dvakrát podtrhne.

    Ten měl a dosud má poněkud zkličující zvyk smát se, kdykoli se v nějakém filmu (nejlépe katastrofickém nebo špionážním) objeví nějaká tabule či papír popsaný matematickými vzorci. Takové ty různé složité matice komplikovaných operátorů, trojité integrály, parciální derivace vyšších stupňů atd.
    S tím jeho manželka tvrdošíjně odmítá chodit do kina, protože kdykoli se tam objeví podobný záběr, jemu připadá zoufale komické, co za blbosti načmárali při natáčení na tu tabuli, začne se nahlas smát a celý sál vůbec nechápe, co je na té scéně veselého a ona se za něj stydí. 🙂

  293. z toho asi pavle plyne to oznacovani klasickejch matematiku za blazny.
    pokud si to syn nerozmysli budu mit neco podobneho v rodine.

  294. K Benešovým dekretům (těm neodsunovým) bych jen připodotkl, že tenkrát bylo znárodňování v módě, masivní (rozsahem zhruba stejné jako u nás) znárodnění proběhlo jak ve Francii, tak v UK nebo v Itálii. Pravda, za náhradu, ale to u nás v roce 45 taky. V UK to narovnala až Thatcherová v 80. letech, ve Francii De Gaulle o něco dříve, ale jen zčásti a pak už nikdo nic (proto je třeba Renault dodnes státní firma).
    Němci měli kliku a vyhnuli se tomu, anžto to tam měli pod palcem Američané, tenkrát ještě bez pošuků typu Kennedy nebo Obama.

  295. No a ještě dodám, že vzhledem k engagement jistého pana Hasenkopfa na Hradě bych bral Klausovy obavy z důsledků šťourání v odsunových dekretech nanejvýš vážně. Stejně tak soudím, že „Klausova výjimka“ z LS asi nebude jen tak rozmarem z plezíru.

  296. 339- za bolševiků u nás byl v Německu Sudetendeutsche Landsmannschaft dosti aktivní a stále si vynucoval nějaké extrabuřty, nicméně nemohl nic dělat vzhledem k uspořádání Evropy( chránili nás Rusáci). Nyní máme ideální příležitost ukázat, jak bychom bez EU (a Rusáků) zvládli chránit své zájmy, třeba právě proti snahám SL.

    To jen tak na okraj věci.

  297. Dobré ránko!

    Obávám se, že mnoho nedorozumění pramení z toho, že se zaměňuje slovo vyhaslý a neplatný. Pod slovem vyhaslý rozumím, že ten který dekret nelze dnes aktuálně použít, protože se vztahoval na činy spáchané za II. Světové války, což dnes spácháno už být nemůže.

    A tak, když se to hodí, začíná se žonglovat s významy těch slov, že vyhaslý je vlastně neplatný a když neplatný, tak od začátku, tedy retroaktivně.
    Což by ovšem znamenalo zneplatnění všech následujících právních aktů, které na dekrety navázaly a nastal by čurbes tak velikej, že si to ani představit neumíme.

    A Listinu práv a svobod bych už do toho vůbec nepletla, protože kdyby ta měla platit retroaktivně, tak se zblázníme všichni. Budeme revidovat čarodějnické procesy nebo Bílou horu?

    Jinak souhlasím s pasáčkem, že kdybychom měli vyhovět všem nárokům, musela by ta republika být aspoň 2x tak veliká…

  298. >> Andy 281
    Ten frajer co udával by mne docela zajímal. Už vzhledem k tomu, že ti hlavní udavači v rámci R3 – Jizera, Paprskář a Ryšánek – to SNB určitě nebudovali.

    >> Andy 309
    Vy snad pochybujete o gramotnosti Karla Schwarzenberga?

    >> Šumavák 326
    Základní německý argument proti zrušení MD „od samého počátku“ je stejný jako argument s.Jičínského et consortes z roku 1990: přestali by mít platnost sňatky a všechno ostatní – a proto to nejde.

    Jinak s navracením vlastnictví ukradeného v důsledku války jsou se svou liknavostí Německo i Rakousko v dobré společnosti Švýcarska, Ruska, USA…

  299. Dobré nedělní ráno. Dovolím si neználkův přípodotek ke „zrušení“ „benešových dekretů“. Zrušení těchto vyvlastňovacích dekretů by bylo stejnou revolucí jako jejich vyhlášení.
    Kdo, komu, co má vracet, pokud více než 60 let je tento právní akt brán za platný?
    Druhý přípodotek: Při sjednocování Německa si Poláci vymohli uznání svých hranic. My jsme o nic takového nežádali, neboť to přeci není potřeba a Němci jsou naši kamarádi. Kdo byl tehdy zodpovědný za mezinárodní politiku?

    Nic lepšího, vyváženějšího a nevzbuzujícího vášně než česko-německou deklaraci podepsanou p. Kohlem a Klausem neznám
    http://cs.wikipedia.org/wiki/%C4%8Cesko-n%C4%9Bmeck%C3%A1_deklarace

  300. Vidite, takhle to dopada, kdyz se k moci dostanou pravnici. Jsem presvedcen, kdyby mohl rozhodovat, samozrejme s plnou zodpovednosti, monarcha, nic takoveho, jako debaty po sedumdestati letech, co je vlastne spravne a co ne, co plati a co uz ne, jestli vyhasle, nebo horici….. Mo to pripada uplne na palici.

    Foundry, jestli bylo znarodneni OK, protoze to byla moda v oirope mne moc neuklidnuje, spise potvrzuje to, ze se nikdo nema spolehat na stat, ktery si plati ve vrchovate mire, ze u v pripade nebezpeci, nebo miru, nebo jen tak, ze se politikum zamane, ti proste seberu vsechno, protoze asfalt. Ale v tom prade nechapu, proc zduraznovat narodni staty, protoze je to furt to same, je to jen otazkou dvou tri generaci amvse se opakuje. Sampzrejme navzdory poucovani historie a dejepisu ve skolach.
    Takze tak…..

  301. Dobré ráno vespolek,
    již nesněží, na teploměru nula, a pod okny mi začínají svištět bežkaři. Takže dnes se asi s dcerou půjdeme věnovat podobné zábavě, když se nám rpo ni včera podařilo sehnat větší boty a lyže připneme už na zápraží :)…

    PavleK, tak toho kolegu docela lituji 🙂 Profesí jsme asi postižení všichni, by mne zajímalo, jestli Loki kouká na katastrofické filmy s vybuchujícími sopkami a zemětřesením (a že jich je ! Možná stejně jako těch počítačových a s obřími krvelačnými mutanty nebo zabijáckými viry…).

    Nemůžu se zbavit pocitu, že tím nešťastným výrokem typu „slon v porcelánu“ Schwarzenberg leda dokázal, jak málo zná národ, jehož chce být čelným představitelem.

  302. Jirko,
    já se obávám, že ty národy nikdo explicitně nezdůrazňuje – a to, kolik vášní vyvolá jedna poznámka 70 let po oné historické události dokazuje, že to „národní“ pořád v lidech je. Byť latentně. Až tohleto, zasuté zřejmě do podvědomí, samo vyhasne, tak vyhasnou možná i ty třenice, a všichni budeme jeden…. Mně to přijde jako dost vzdálené schi-fi. Pořád se budou mydlit „dolňáci“ s „horňákama“, sešívaní s rudýma, prostě jedna skupina proti druhé. A manuály z Bruselu vymývající v tomto směru mozky jsou fakt stejné, jako ty o socialistickém internacionalismu a proletářích všech zemí.

  303. 345 Jirko, Mikuláš II, Vilém II a FJI s Karlem I-III-IV to také moc nevychytali. Někdo by řekl, že místo matky všech válek stvořili otce všech průšvihů. V kotlince by nikdo rozumný do roku 16 neměnil císaře za národní stát. Leč hlavy pomazané chtěly jinak. Už mlčím, moc si pamatuju 🙂

  304. zdravím: koukám, že jste si k dnešnímu všeobecně nesympatickému počasí vybrali správné téma 😕
    Mé(kusé) informace k tomuto tématu (i když zřejmě na rozdíl od většiny zdejších diskutérů bych měla být pamětníkem)odpovídají zhruba tomu, co v předchozích příspěvcích uvedli PK a Šumavák; mohu jen odkázat na výňatek jisté (možná nevěrohodné) knihy (možná nevěrohodného) autora T.Krystlíka ohledně reparací 😕
    http://hedvicek.blog.respekt.ihned.cz/c1-46055920-povalecne-reparace-a-restituce
    Zda je tomu možno věřit, nevím 🙁

  305. A i k těm západním Mongolům dovezli přes Karelii zapečetěného Kalmyka z ciziny. To nebyla vůle lidu, ale vůle císařského Abwehru.

  306. Monarcha Přemysl Otakar I. rozhodl s plnou odpovědností, že se nedá nic dělat a má-li Kotlinka prosperovat, musí se už konečně odvodnit a odlesnit, aby se mezi těma bažinama vůbec dalo žít a za tím účelem rozhodl se do kotlinky pozvat německé kolonisty pod podmínkou, že přidělené (zajisté zdarma) pozemky patřičně zvelebí. Jak nějakej Zeman blahé paměti … 🙂
    A tak nám ten monarcha zadělal, o ani ne 800 let později, na parádní průšvih.
    Malou Stranu ten, zajisté inteligentní a odpovědný vladař, založil tím způsobem, že prostě přijeli královští vojáci a ty chatky a polozemnice, kde bydlela nějaká bezvýznamná sběř, prostě rozmlátili na cimpr campr a sběř vyhnali, čímž byly pozemky připraveny k osídlení.
    S nějakým sociálnem se monarchové moc neto… to …. nepatlali … 🙂

  307. Ale jiste, ja vubec nemam problem s tim, se mnou nejen nikdo nesouhlasi a zaroven jsem argumentacne umlacen cepicema..vzdyt v podstate jde z me strany jen o takove „retoricke a teoreticke cviceni“ vzdyt to preci musite videt take, ze to v dnesnim svete neni dost dobre mozne, zvlast po vitezstvi v Naganu, kde se potvrdila platnost benesovejch dekretu poskoky a volanim.

  308. (345) Milý jirko pp, chápu Váš příspěvek tak, že by bylo vše v pořádku, kdybyste tím odpovědným monarchou (asi pro celou Evropu,když národní státu jsou fuj) byl Vy 🙂 Jinak si dovedu představit, že být jím někdo jiný, s Vaším remcáním byste velmi brzy skončil (v tom lepším případě ) někde ve sklepě (nepíši v Daliborce) 🙂

  309. No westku, jak to jen delate…. Nejen ze zase spatne, ale uz ani ty invektivy vam nejdou tak jako driv…..

  310. 352 Jirko, určitě vás nechci utlouci čepicí 😉 I parlamentní demokracie, i monarchie má své chyby. Monarchie mají výhodu dlouhodobé stability, dokud panovník žije. Co se bude dít, když panovník skoná (naposledy vydechne)? To jsou období zmatků a zmaru.
    Demokracie má nevýhodu permanentních voleb. Všeholid může znárodnit kdykoli, cokoli, dokonce i kohokoli.

  311. Jirko,
    mícháš hrušky s jablkama. Koho jsme v Naganu ve finále porazili 🙂 ?

    Hele, zkus jít do hospody francouzské, srbské, řecké…. a říct jim, že nejsou Francouzi, Srbové, Řekové, ale jeden evropský národ, a že si mají potřást tlapkou a poplácat po zádech se Němci, Albánci, Makedonci…. Skotům vysvětli, že jsou vlastně UKánci, potažmo europeici, Baskové dtto. Jak z toho nepokapou EU dotace, bude po evropanství. IMHO.

    Hmm, jak tak koukám ny vývoj v USA, chvílemi mi přijde, že se odstředivou silou federace rozpadne a „národy“ vzniknou na základě stávajících států unie.

  312. Nickname, ja to tak preci nemyslim, ja jsem chtel pripodotknout, ze „muj“ system je v podstate mrtvej a ze se po spirale vznasime k necemu jinemu a asi i osklivejsimu, nez je dnes. Samozrejme po chvili prekrasne svobody pro jednu generaci.

    Jinak jsem poslouchal, chvilku pana Janecka. Musim rici, ze jsem to po case vypnul, nemam chut na mluvene slovo, kdyz si planuji dovolenou a hledam nejaky majak, ale zaujala mne jedna vec…. Rikal neco v tom smyslu, ze lide by meli spise neco vytvaret, jinak prej nebudou spokojeni. Coz za mne opravdu velmi souhlasim. Samozrejme ze mi kdokoliv muze namitnout, ze to je klise a v podstate jasne, ale kdyz to vztahnu na stav dnesni spolecnosti, tak kolik lidi to dela? 20% lidi? A to jsem si jeste zaprehanel….. Pak to vypada, tak jak to vypada…..

  313. Matzurko, nejsem chovatelem psů ! Ale poněvadž mám chovného psa, něco (málo) o jejich křížení (alespoň u klubu amerických kokrů)vím; klub má poradce chovu, a ne každý čistokrevný pes je chovný (mj. k uchovnění se např.musí předložit potvrzení o vyšetření očního pozadí, které by prokázalo některé genetické vady). Jinak chovatelé, aby zabránili příbuzenskému křížení, si půjčují chovné psy z celého světa (např.u předků našeho psa se dá říci, že „každý pes- jiná ves“ (např. otec je Rus, babička z matčiny větve Australanka, atd.) 🙂

  314. Neeeee Matzurko, ja preci nejsem proti narodum a ze vsichni si budeme rikat po zakazani nazvu narodu, oiropane, ci zemekoulane. Ja jen poznamenavam, velmi potichu, ze idea narodnich statu je slepa ulocka zvlast pro ty mensi narody, ktere vzdycky ostrouhaj. Takze jestli by nebylo lepsi se orientovat na neco jineho, treba prave na to vetsi spolecenstvi, kde budou narodove zit ve svobode at si rikaji jakkoliv. Proste bez tech narodnich satrapu bez odpovednosti ve vetsi svobode, nejen v cestovani.

  315. Jirko, já nepsal, že znárodnění bylo OK, protože znárodňovali všichni. Já napsal, že znárodňovali všichni. Tečka. Popis, nikoli hodnocení, to ani nepovažuji za potřebné. Jen jsem chtěl poukázat na ošidnost redukce důvodů na přítomnost komunistů ve vládě. Ti u nás jistě přispěli, třeba v UK však nebyli.

  316. (355) jaképak invektivy ? Invektivy představují emoce, a těmi já šetřím 😕
    Odpovídám na to, co píšete ,a co z toho Vašeho „psaného“ logicky vyplývá 😕

  317. Jirko,
    to možná ano, ale jak vidíš všude možně, hodně lidí (možná většina) si to nemyslí, a nejen v Kotlince. A rozumově je nepřesvědčíš, podstatná část voličů je typu „hop, hop, hop“. Nakonec když jde do tuhého, menší území se lépe brání…. ?
    Určitě by větší společenství pomohlo, ale musí to jít opravdu spontánně, si myslím.

  318. Jirko, ad Janeček. Hezky povídá, jak se má pracovat, taková ta drobná činorodost.
    A těší se, až získá milión, dva stoupenců. A nikdo si nedovolí protestovat, protože by mu v hospodě rozbili hubu.
    Mluví o zlojedech, aktivně spolupracuje s Kalouskem. Má ambice na prezidenta. To je ta nepolitická politika.
    New Age ano, ale vocať pocať.

    Ad krásné staré časy. Svázání Rakouska s Pruskem zničilo tyto časy. Kdo zabil Rudolfa?

  319. (364)Matzurko, „Určitě by větší společenství pomohlo, ale musí to jít opravdu spontánně, si myslím.“ No, v tomto směru jsem skeptik 🙁 Jednak pokud se týče té spontánnosti , jednak o lepší řízení těch velkých celků – v tomto směru je historie opravdu učitelkou ( jen -opakuji- ti žáci jsou pitomí) 😕 Pokud lidé jsou (a budou) takoví, jací jsou ( a ta kulturní evoluce je fakt strašně pomalá), pak velké celky nemají dlouhodobé trvání; pokud by lidé přestali být iracionální, pak ovšem zase velké celky jsou zbytečné 😕

  320. Dobré dopoledne,

    335 – Kořenský, přece nečekáte, že ve filmu, kde hraje Sandra Bulock, jsou důležitý nějaký čísla. Ženský těm cifrám stejně nerozumějí a u chlapů se očekává, že koukají nějak úplně jinam. 😀

  321. Ahoj! Jirko ppa, ad 360 – zkus to vykládat v Izraeli, jak to podělali, že se odstěhovali z EU i když jim Hitler daroval město…

    Pokud jde o ten, v Německých novinách očekávaný, „výron nacionalismu“ či zapomnění, tak kdy jindy než při volbě českého presidenta?

  322. Dobré dopoledne,
    na filmech ala Sandra Bulock mne fascinuje, že po cca 2-3 pokusech se hrdina trefí a na klávesnici ledabyle vyťuká správně přístupové heslo do supertajné databáze… To bych chtěla umět, po každé dovolené, marně vzpomínám na heslo k účtu a hystericky prohledávám možné úkryty na lísteček, kde ho mám napsané 😀

  323. No jo … Uz tedy vime, jak se to delat nema a kde jsou chybicky, ci zakopanej westhajlendrterier, ale co s tim muzeme delat? Ne neodpovidejte, sam si to nastinim….. Nic:-)

    Nepoliticka politika je takoveho neco neuchopitelneho, stejne jako obcanska spolecnost, proti ktere ja rozhodne nejsem. Nemyslim si, ze by lide meli drzet usta a jednou za cas dorazili k volbam, kde by potvrdili politikum, ze jak to delaji mene spatne, nez druzi.

  324. No jo Sumavaku, ale to je stat na spise nabozenskem zaklade a ta etnicka prislusnost je kapku odvozena, od te nabozenske.

  325. Jirko, od nepolitického politika – soukromníka bych čekal vyjádření podobné tomu I.M. Jirouse a S.Pence na adresu S.Grosse.

    http://blisty.cz/art/19224.html

    Nepolitická politika je, když se úředník nemotá soukromníkovi pod nohy.

  326. kdyz si ctu co sem pastnul westik tak je videt ze se klasicky cesky spekulovalo kalkulovalo az se to podelalo.
    no mohou za to ale ti druzi.

    dobre to tu napsal vlastne dvd
    „Jinak s navracením vlastnictví ukradeného v důsledku války jsou se svou liknavostí Německo i Rakousko v dobré společnosti Švýcarska, Ruska, USA… “

    ano maji na to koule – tak co? mame je taky ? Klaus to zkousel u LS ale nevydrzel , ostatni to vzdali mnohem driv a LS schvalili.

    to z toho narodniho – z toho osobniho bych rekl ze majetky nikdo brat nebude , budou maximalne nahrady.
    Ale kdyby nahodou joo a museli by se vracet nemovitosti – no vzdyt to tu jirkovi porad pisete doba byva obcas nespravedliva k jednotlivcum.

    nekoho obral benes druheho obere gottwald dalsiho poselt.

    no jo a budeme tu v tom pokracovat az prijde mohamed a vezme si to vsecko – tedy nas ne nas jako suverena obejde.

  327. nickname,
    jestli to prohlášení dobře chápu, tak by bylo v pořádku, kdyby CzechTec rozprášila domobrana složená z obyvatel, kterým vadí, že se do nich serou účastníci CzechTecu svým kraválem a bordelem. A protože si obyvatelstvo celej produktivní život platí partičku lidí, aby se o takovéhle záležitosti starala, pak je v pořádku, že ta placená partička lidí rozhodila leckterým účastníkům CzechTecu sandál. Nevím tedy, na co si ti dva pánové stěžují 😀

  328. jirko,
    nepolitická politika, podle svých vykladačů, znamenala, že ve společnosti budou určovat směr nikoliv volení zástupci politických stran, ale všeobecně uznávané morální autority. Kdo je všeobecně uznávaná morální autorita, se jaksi neřešilo, u přívrženců nepolitické politiky to znamenalo „ten, koho uznává Havel“. Jakou definici majíi teď, to netuším. Možná to bude kníže, pokud ho zvolí.

    Občanská společnost, rovněž podle svých vykladačů, znamenala, že občané se budou sdružovat do spolků a sdružení dle svých potřeb a zájmů a sami hájit svoje aktivity.
    Bohužel na leckteré tradiční sdružení – třeba dobrovolné hasiče nebo spolky včelařů a zahrádkářů bylo výše uvedenými mudrci nahlíženo s despektem, zatímco leckeré rychlokvašené nadace, jejichž hlavním popsláním bylo dát si honosný název, dostat dotaci, zviditelňovat se morálníně hnumanistickými plky plky byly tím pravým základem ůpbčanské společnosti“ nebo ve jménu veřejného blaha pod hlavičkou občanských sdružení například zasahovat do stavebních řízení a vydírat stavebníky.

    Sorry, ale pro mně jsou tím oba pojmy jednou pro vždy zdiskreditovaný.

    Jo, souhlasím, že že zájem o život veřejný není jen to, že jednou za čas dojdu k volbám a v zásadě asi nejsem proti tomu, co nazýváš občanskou společností.

    Ale protože tady se vžil tenhle pojem pro něco, co s ní nemá ani za mák společného, tak si prostě budeme muset najít nějaký jiný termín.

  329. 376 Ptakopysku, zásah policie na CzechTeku pod Přimdou nebyl kvůli porušování zákonů, ale kvůli tomu, aby vláda – a policie ukázala ramena.

    http://blisty.cz/art/24521.html

    Ač nejsem technař, z hlediska vyššího principu mravního jsem se zastával zákonného pořádku v naší zemi a alespoň písemně jsem se zastával utlačovaných proti tyranům.
    Policie by měla dodržovat zákony naší země.

  330. Nojo, Jirko, ale Čechy je stát spíše na bezbožném základě a ta etnická příslušnost je kapku odvozená od té náboženské.

    V čem vidíš rozdíl? A nezamlouvej to, v EU je přece svoboda náboženství, ne? 😉

    Snad jenom, že až Schw. podepíše (připravenou) smlouvu s Vatikánem, bude zavedena povinnost, aby ve školách v každé třídě visel ne obraz presidenta, ale kříž.A znova začne rekatolizace. Viz církevní „restituce“.
    Zda se povede je jiná otázka.

    Já si teda osobně myslím, že tyto volby nejsou jen o tom, kdo bude klást věnce a pořádat recepce. Fakt ne!

  331. No jo, to je pak tezky…. Nemame tedy spolecnou terminologii. To by se v bilogii stat nemohlo a v nemecku teprve ne 😀

    Ano, rozhodne souhlasim s tim, aby se politici a urednici nesrali do podnikani a zivota skoro nijak. Tak by to melo byt. Jenze tady je proste problem s tou demokracii. Protoze politici si memohou nechat proklouznout moc mezi prstama. A co jineho je ovlivnovani, nez moc na ostatnima

  332. Sumavaku, stat musi stat na necem…. V podstate na cemkoliv na cem se jeho obyvatele domluvi. Jestli je to nabozenstvi, nebo pestovani nejlepsiho krenu, je jedno. Ale nejak se to proste musi vymyslet. Vubec to nezamlouvam, je jen otazkou, jak silna je ta jednotici idea.

    Jestli nto jsou dulezite voby? Ano uda se to tak, vysledek ovsem bude stejne tristni, jako pokazde, kdyz jsou smrtelne dulezite volby.

  333. Jirko,
    pokud máš čas a mlíko, můžeš založit své vlastní sdružení, získat příznivce, vyhrát volby…. 🙂

    Westíku, ideály jsou krásné, a bez nich by byl život smutný. Ale doufám, že s blížící se padesátkou mám už idealismus za sebou a konečně začínám být realista…

  334. Včera jsem na jednom večírku vedl debatu na probíraná témata s jedním Němcem (mimochodem, taky „von“). EU proklínal do horoucích pekel, obzvláště a specielně Schultze, Barrosa a Rompuye, zvláštní pozornost pak věnoval baronce Ashtonové a komisaři Oettingerovi – jejich blbost hodnotil jako vymykající se běžným měřítkům.
    Oproti jeho expozé bylo místní PeSovo občasné remcání jen laskavým napomenutím 🙂
    Takže nejen Čechy se vyznačují EU-kverulantstvím.
    Zajímavé bylo, že vysoce hodnotil Klause a velice litoval, že VK končí v úřadu.

  335. nickname,
    stran čekteku u mě funguje NIMBY na 100%. Pokud je takováhle akce aspoň kilometr daleko, jsem smířlivý, pokud je blíž, neskutečně mě sere a mám chuť to celé nechat anihilovat.
    Můj příspěvek se ale týkal myšlenkových pochodů těch dvou disidentů v.v. Taky takové jejich malé rozšlapané NIMBY 🙂

    To, že si nadržená zásahovka na čekteku udělala hezký den a zahrála si bojovku, to je snad každýmu jasný. Kluci ze zásahovky prostě potřebujou nahromaděný testosteron někde neutralizovat. Třeba někoho v souladu se zákonem zbušit. Koneckonců proto v té zásahovce jsou. Není lepší možnost, než si zamlátit do nějaké demošky, nebo vybouchat nějaký vlasatce, dredaře, smažky, intoše, nebo jiné závadné živly. Kombinace Standíka s čektekem byla pro tuto besídku pomocné školy naprosto ideální.

  336. Tak nevím.
    Když soused začal v rámci podnikání odstraňovat ve velkém izolaci z kabelů opalováním, tak mu ti okolo nešli rozbít hubu, ale požádali, aby se mu úřadníci do toho podnikáni sráti začali. Nicméně učinili zřejmě dvě chyby: on to přeci dělal na svém pozemku, kde si přeci může dělat co chce a umožnili tak třetí straně („páteři“) stát se účastníkem akce. Jakže to pravil Švejk? „Já mám moc rád, když tak lidi blbnou na kvadrát.“

  337. „Já si teda osobně myslím, že tyto volby nejsou jen o tom, kdo bude klást věnce a pořádat recepce. Fakt ne!“

    Asi máš pravdu, Šumaváku, ale v tomhle obsazení a v té atmosféře vzájemné nenávisti to bude tristní v každém případě.

    Pořád se říkalo, že Klaus rozděluje národ. No, tak nastávajícímu prezidentovi, ať už jím bude kdokoliv, se povedlo fakt unikum : rozdělit národ ještě před volbama.

    jirko, k obědu budu dělat křenovou omáčku, tak pak poreferuju, jak je to s tím křenem…..

  338. Matzurko, neprovokuj, vzdyt to vidis i tady, bal bych nejen preceda, ale i pokladnik, sberovy referent a taky jediny clen nove zvolene strany. Ne ne, nejsem spravny meiassky typ.

    No ale dost jiz bylo trapnych , mojich, pripspevku, kde si provnaváe navzajem hrusky a jablka a probirame ovce a vozy …… Nemate nekde nejakej zasutej tiip na prenosne, lehoucke a blbuvzdorne zarizeni, ktere se bez naroku na energii dokaze zaridit z morske vody vodu pitnejsi? Ja vim, mam ho na lodi v zachranem clunu, ale tam je to zabalene a uzavrene s napisem, otevrit jen v pripade nouze. No a ja nemam nouzi na otevreni. Musel bych koupit uplne celej set znovu a to nechci. Takze existuje neco takoveho, v samostatnem prodeji?

  339. 388-ten projekt dotažení Baltu do severních Čech byl dokončen tak rychle ?

  340. JHpo a tou terminologií :
    Až nedostane stavební povolení včas, protože si nějaké občanské sdružení vzpomnělo, že chlív pro ovce hyzdí pastvinu a navíc ty ovce žerou chráněné byliny a zablokují tím řízení a budou ochotni ustpoupit jen tehdy, pokuid přispěješ k ochraně přírody tučným příspěvkem do fondu na ochranu ovcí a kytek, ( z kterého pak poberou dotaci), pak vez, že máš před sebou výkvět pobčanské společnsoti a sklízíš její plody.

    Samozřejmě, úředník by Ti mohl vypsat stavební povolené i bez souhlasu občanského sdružení, jenže to se zaručeně odvolá a povolení, které bylo vypsáno, bude zrušeno a vráceno k novému projednání. Ztriáta času několik měsíců, kolik by tě to stálo finančně, to si zhodnoť sám.

  341. NoName,
    možná, že Jirkovi ppa to spoluobčané žijící na Jirkovi zabavených pozemcích pořádně osolili. 🙂
    Jednalo se o pozemky po prapradědečkovi – zavilém Valdštejnovci, zabavené císařskými, pozemky zabavené husity katolické praprababičce Jiřince Plzeňské, pozemky zabavené katolíky husitskému hejtmanovi Jirkovi Tachovskému po bitvě u Tachova, pozemky protestatského hraběte Jirky ze Zámku po bitvě na Bílé Hoře, pozemky zabavené I. pozemkovou reformou, II. pozemkovou reformou, Lex Jirka ze 47′, znárodněním… xakru, došel mi plac na glóbusu 😀 😀 😀

  342. 385 ptakopysku, v tom případě czechtek 2005 splňoval podmínky – být aspoň 1000m od obydlené oblasti. Některé domky byly blíže než 600metrů, oddělené dálnicí. Ne že bych tento typ zábavy obliboval – a sám bych byl raději, kdyby se konal alespoň 5000 metrů od mého vigwamu. I z této vzdálenosti připomíná hromobití.

    Politická odpovědnost za zásah policie byla vyvozena – Paroubek prohrál volby.

    386: dvd, když nepomůže přátelská sousedská domluva, nezbývá než vypustit krakena.

  343. O ne Noname, nikoliv projekt oteplovani zemekoule se trapne vytratil, stejne jako pestovani palem v hrensku. Jen planuji co s nacatym letem a zjistili jsme ze mame tak malo casu, ze nemuze letet daleko a tak vyuzijeme nabidku jednoho znameho na pobytu na ostruvku s majakem. No a protoze bych chtel, jako vzdy, vymyslet nejake ozvlastneni, tak sice priplujeme vlastni lodi, ale pristaneme na gumovem clunu jen se svihadlem okolo pasu a nozem s malovanou strenkou. Hlavne bez zasob.

  344. Ptakopysku, zapomnel si na to nejpodstatnejsi, pochopitelne to zacalo daleko drive. Napred nas okopiroval Noe a pak uz se to vezlo 😀

  345. „Já si teda osobně myslím, že tyto volby nejsou jen o tom, kdo bude klást věnce a pořádat recepce. Fakt ne!“
    Sdílím váš názor, Šumaváku. Musím uznat, že pomalá, trpělivá a soustavná práce médií v německých rukou přinesla kýžené plody. Všechno bylo dobře připraveno, podpořeno nemalými prostředky a manipulace přitroublým a důvěřivým českým ovčanstvem se povedla.
    Je vlastně komické, že si nakonec Češi zvolí svého von Neuratha sami, a budu se srdečně smát, až Jeho Jasnost bez mrknutí oka jmenuje vládu s komunisty. Zaorálek se Sobotkou jsou proevropští a komunisté jsou i v euparlamentu.Jsme přece demokrati.

  346. nickname,
    já bydlím na takovém zvláštním místě – esoterik by řekl že magickém a leckterý proutkař by tam našel kosmetické síly proudící od Proximy Centauri komínem dolů so sklepa. Eh.. čo to táram… prostě když je nahoře ve vsi na parketu zábava, slyším ji, jako kdyby mi Vysoký napětí či Dusající žížala hráli dostaveníčko pod oknem i když jsou zmíněný kilometr daleko, protože parket je na kopci u lesa který dělá dokonalou ozvučnou stěnu. Totéž je u zábavy v mé rodné obci, vzdálené čtyři kilometry, protože tam se zvuk nejspíš táhne údolím a pak nejspíš odbočí vlevo na státní silnici a mám ten rumrajch u baráku. Co je mi záhadou, že slyším i čurbes ze zábav ve vsi za lesnatým kopcem. Jedno mají všechna tělesa společné. Hrají a zpívají příšerně falešně, ujíždějí z rytmu a když se to vyfiltruje několika echy a protáhne se to skrzevá smíšené lesní porosty…. skoro bych řek, zlatý technařský tuc tuc méďa béďa. 🙁

  347. Jirko ppa,
    😀 a to jsem nezmínil roztržku s Federací. Pamatuješ, jak u vás kapitán Piccard uklouzl po ovčím tentononc a znečistil si uniformu, vlkodav Zbyšek ukořistil vypadnuvší klíčky od Enterprise a zahrabal je pod rybíz a tvoje paní se nevhodně vyjádřila o nemožném oblečení poradkyně Troy. Tehdá jste málem přišli o pozemky, co jste měli pronajatý od Klingonů.

  348. Jak pronajaty… Normalne jsme si je zabrali, kdyz povrch trosku vychladl. Ja nevim takovy strachy se zaborem 😀

  349. je parada jak se to tu prolina.

    no ze neco ukradli bohacum – je spatne ale dano dobou az spravne protoze to stejne nakradli !!! Dulezite je to podlozit treba dekrety benese.

    ze ted neco mohou ukract obcanum CR – je spatne az trestne . ac by to muselo byt podlozeno zakony a soudy.

    ze by za to ukradene mohli mit nekteri obcani CR mensi duchody a davky – je svetova krivda a je potreba CR dat pod ochranu cara.

    jo ze jde vzdy o to stejne – neni ochranen majetek obcana – je jedno .

    Proc ? protoze nemec.

  350. Pepo, clovce, taky ti pripada, ze jedina idea od roku 1918 tedy od vzniku republiky je zasadni a naproste vymezeni vuci jiznim sousedum? V podstate nic jineho nestmeli narod tak, jako sudetsky ledrhoze v Mnichove, ci film o cisarovne Sisi 😀
    Na druhou stranu, musim pripustit, ze jakakoliv idea statu je dobra, coz jsem taky napsal uz davno a i dnes.

  351. 2 Foundry – ad 384 – No asi je zná osobněji… Já je znám jen ze Skutků apoštolských…
    No a to hodnocení Klause má svou logiku – už Grossman si chtěl pošpitat s diváky o spojeným nádobí…
    Jinak – těch „von“ znám několik osobně, co se věnují vědě… A s fenoménem silného euroskepticismu a silné eurokritičnosti jsem se setkal u většiny z nich.

  352. jirko mozna by si vsichni meli zkusit tak obektivne v soukromi ( ne psat to by se nesmelo zverejnit ) projit kdo jejich rodinam a rodum vic a vickrat ublizil.

    byli to vic nemci? cesi? rusi?

    vis ona idea statu je super – ale taky si ten stat musi uvedomit co je a muze.

    stejne jako ja si musim uvedomit ze asi nemam na to co ten bill od voken tak by si asi i ta kotlina mohla uvedomit kde stoji.
    dulezite je aby mi nebylo moc braneno se snazit , prodavat jabka a setrit dolar k dolaru az toho voknare predezenu.

    ja vim zkusit mu to sebrat pod zaminkou idee statu je cesta rychlejsi ale nekdy muze narazit.

  353. nickname,
    jako bývalý obyvatel Ledče nad Sázavou jsem motokrosem takměř odkojen. Ten mi nevadí. Ale nahoře ve vsi je famílije, jejíž synové vlastní obchod s terénními motocykly. A oni sami se projevují tak, že na kroskách jezdí na jaře po čerstvě zasetých polích, a když plodiny povyrostou, nasednou na vysokootáčkové rejže s motorem na principu náhodných výbuchů a rvouce tyto na plné otáčky, jezdí mi trasu dlouhou dva kilometry po silnici před barákem sem a tam třeba celé odpoledne. Jediné, co na ně zabírá, že si na tu silnici stoupnu s vidlema. Mmch, když slyším ty vyladěné motory, divím se, že ještě nezkrachovali.
    Když už beru motocykly do klábosnice, já se mám ještě fajn, ale obyvatelstvo úseku Košetice až Červená Řečice to má ještě lepší. Tam se jim shromažďujou silniční motorkáři a serpentýny na trase jezdí jednotlivě i ve skupinách na čas. Když jedu do Pelhřimova, tak trnu, kolik debilů proti mě vyletí v protisměru a co udělaji.

  354. Ledče nad Sázavou? Hele, odtamtud byl můj otec. Teď tam jezdím párkrát za rok na hřbitov a pokaždé čekám, že kvůli tomu debilnímu příjezdu na náměstí skončím v obchodě s nábytkem a pak taky na tom krchově.

  355. 385
    jen připomínám, že tehdejší premiér paroubek z rakouska zavelel, aby policie zasáhla razantně!
    jako vždycky se pomýlil a místo vděku se dočkal demonstrací

  356. Češi zvolí svého von Neuratha sami, a budu se srdečně smát, až Jeho Jasnost …kristepane, Baubo, jestli bolševici vyhrajou výrazně volby, tak asi panu Schwarzenbergovi( všímáte si, že jak on, tak my feudalisté zásadně nepoužíváme pro KS tituly? Nepotřebujeme je urážet) nic jiného nezbyde. Možná kdyby se pravice(ehm) tak nesnažila bolševikům hrát do noty a navíc je pečlivě chránit, aby nemohli být zakázáni, tak by se vlády už nikdy nedočkali.
    Možná…vlastně zcela určitě.

  357. Andy,
    jo, ledečskej hřbitov…. Mám pocit, že kromě několika hřbitovů v Cornwallu, je tenhle snad jedinej v Evropě, kde jsou hroby vykopaný do skály. Ale co by člověk chtěl od města, kde je kostel v největším dolíku záplavového území, zámek si přestavěli na hrad a kvůlivá dvoum barákům mají půlku města jako památkovou zónu…

  358. Divano, tak si říkám, že když se pan Schwarzenberg rozhodl pro kruhovou obranu a najednou ostřeluje pana Klause i pana Zemana, asi bude mít problém. Co když naštve bývalé voliče Klause i Zemana a oni demonstrativně hodí hlas Schwarzenbergovi?

    Pan Paroubek to projel díky agresivitě. Pana Schwarzenberga se také povedlo vyprovokovat.
    Uvidíme, co ještě vytvoří mediální mágové.

  359. Odkazy:
    http://www.novinky.cz/domaci/290759-zeman-s-klausem-tvori-mocenskou-skupinu-tvrdi-schwarzenberg.html
    Prezidentský kandidát Karel Schwarzenberg v neděli v Olomouci uvedl, že jeho protikandidát Miloš Zeman vytvořil mocenskou skupinu s prezidentem Václavem Klausem. Oběma jde prý pouze o udržení moci. Podle Schwarzenberga jde o podvod na voličích.

    Nebo je nervózní kvůli paní Parkanové?
    http://www.novinky.cz/domaci/290750-kvuli-kauze-casa-vypovidal-schwarzenberg-na-policii.html

  360. nikcname, ano
    vždycky je zajímavé sledovat naštvaného protivníka, tam se nacházejí ty ukryté černé díry

  361. no a kalousek jako obvykle při volbách je neviditelný

  362. 413- mně se ten hřbitov líbí, je takový…klasický. Rodina má hrob hned u dolní brány, tak se vždycky dívám na panorámata- když jsme tam jezdili za prarodiči, ještě nestály paneláky a bylo to pěkné. Dneska je Ledeč trochu šílená díra…děd toužil po tom, abychom se my dcerky provdaly za inženýry z Kovofiniše a žily tam, ale nám to připadalo jako osud horší než smrt, jak se říká:)

  363. Jó, není nad to, když se pravda k lásce vine – to se pak dílo daří…
    http://www.lidovky.cz/skoncili-jsme-s-nim-vzkazuji-tvurci-zdivocele-zeme-stransky-a-bocan-dejdarovi-kvuli-zemanovi-ifv-/lide.aspx?c=A130118_184836_lide_jkz

    „Tvůrci populárního seriálu Zdivočelá země se naštvali na protagonistu hlavní role Martina Dejdara. Režiséra Hynka Bočana a scénáristu Jiřího Stránského rozlítila hercova podpora Miloše Zemana v blížícím se druhém kole prezidentských voleb. „Skončili jsme s ním,“ píší Stránský s Bočanem.“

    Inu, není nad demokracii a odpor k jakékoli formě diskriminace. Že? A hlavně se kochám, jak nám ta pravda a láska tak hezky vítězí nad lží a nenávistí…

  364. Andy,
    já na ten hřbitov nahlížel z pohledu hrobníka 😀 Tuhle profesi bych v Ledči vykonávat nechtěl. A Kovofiniš? Kde je mu konec… Ono je to umění položit monopolního výrobce galvanických linek a lakoven ve východní Evropě. A přitom ten pán, co se mu to povedlo, byl zvolen v těch rušných poplyšákových dobách místními revolucionáři za ředitele. Když jsem odtamtud odcházel, byla u banky zastavena i kovofinišácká kanalizace. A ten komunistickej neschopa, co byl revolucionáři sesazen, si každou chvíli kupuje nový vidle na přehazování peněz, který vydělal, založiv si ihned po sesazení firmu a pustiv se ruče do práce. Teď by se zchudlým revolucionářům mohl smát do xichtu, kdyby chtěl.
    No a od té doby se to v Ledči furt takňák sere.

  365. ptakopysku nebo ti hrobnici mji zkusenost .
    rozdelaji ohen pak to zaliji vodou – tak pokracuji az je hrob dost hlubokej.

  366. (383) no jo, Matzurko, ideály jsou krásné, když se o nich debatuje v univerzitním kroužku; jak se začne s jejich realizací, jsou to samé průšvihy nepravidelně po sobě jdoucí 🙁

  367. Hm, tak koukám že to bere dobrej směr….

    Jak vidno, kníže má opravdu našlápnuto k tomu, aby národ spojoval, když má tak oddané fanoušky…

    a co teď udělají s tou Zdivočelou zemí? nechají Maděru popravit a pokračovat budou o potomcích, ctících jeho odkaz? Ale ono to asi došlo ( já to nesleduju, takžeb nevíkm) už někam skoro do devadesátých let, ne?

    No, mohlo by ho klepnout nad opoziční smlouvou. To by byl takový hezký závěr. Alkorát by se to muselo natočit s nějakým dvojníkem, když s tím darebákem Dejdarem pánové skončili.

  368. pepo,
    mám takovej matnej dojem, že voheň jo, bez vohně by nehořelo cígo, ale voni se hrobníci spíš nalejvaj, nez zalejvaj a spíš rumem, než vodou.

  369. Ad 419 – no já jsem vždycky říkal, že přímá volba presidenta je blbost. Ale že to nabere až takový grády, to mně opravdu nenapadlo. To už je jak za komančů, kdy od jisté doby nemohla jít v TV Noc na Karlštejně, protože v ní hrál Matuška.

  370. 425- podle mne to žádné velké grády nenabralo, holt billboardy od dálnic mizí, prachy na kampaň došly, tak se jede podle levnějšího modelu.

    426- zřejmě tu amnestii nenapsal nikdo- a mně se přitom docela líbí. Pořád čekám na nějakou zástupcovskou státní a soudcovskou sebereflexi, že se se vším tak serou…a furt nic.

  371. Rputi,
    psssst! To psal ten Koudelka z STS Chvojkovice – Brod

  372. Nestranný komentátor na ČRo Lukáš Jelínek mluvil o Zemanovi-Klausovi „každý chvilku tahá pilku“, nešťastném vyjádření o dekretech – vyhaslý x neplatný. Ani slůvkem se nezmínil o Haagu. Ještě že si platíme těch 9mld. kč/rok za nezávislá veřejnoprávní média.

    Někdo se upálil na václaváku u Muzea nebo Na můstku.

  373. nickname nejsem vstoupenec pravda a lasky ani socialismu demokraticky nedemokratickeho.
    ale videl bych tu snahu obou stran o stejnou nevyvazenost kde to jen jde.

    ze se to chytila cela rodina klause mne jenom prekvapilo.

    My pasacci co se ale neucime z historie ty niance proste nechapeme.

  374. a na sportu biatlon, našíííííí … nevidím ale placky

  375. 2 Pavel Kořenský – ad 425 – a nemohla jít Zlatovláska, protože tam zase hrál Tříska…
    Ale nelze přece srovnávat štvavou propagandu Matušky a Třísky vůči pracujícímu lidu, která byla oprávněně zatrhnuta se situací, kdy si támhle nějakej Dejdar demokraticky otevře hubu a nerespektuje kolektivní rozhodnutí Národní fronty – pardon, umělecké…
    S takovými živly je přece třeba řádně zatočit, asi jako před časem zatočil Svěrák s Vondruškou…
    Aneb, jak pravil Čenda Krchov:
    „Lidu se povolila uzda. Což ovšem já, Čenda Krchov, nepovažuju za docela správný. Soudruzi, vždyť dneska nám do všeho mluví každej. Řeknu vám, já jsem viděl dokonce i němýho, kterej ukazoval rukama úplně jinak než před krátkým časem. Týhletý povolnostě využívaj různí živlové a elementi k naleptávání jednoty.“

  376. A spolu s Pupákem bych rád popřál lidem, aby co nejdříve znovu získali svobody Prosincové ústavy z roku 1867, která zaručovala svobodu osobní, tiskovou, spolčovací a shromažďovací.

  377. pravice bránila zákazu komunistů ….. bože do čeho sto duši dal ????
    Jednak tady byli lidi okolo Wendy Hafela s jejich hysterickým humanismem, druhak tady byla vždycky levicová většina (která volila právě Havla, pak jančila okolo různých model typu Švejnara a spol. a teďka se lokajsky cpe do imaginární záře nobility Kalouskova fořta) a třeťak se místní rektoskopové snažili dostat do Euroříše vedené už v té době (prý) bývalými maoisty…
    Kde tady někdo vidí příležitost pravice (ať už si pod tím představujeme cokoliv) k možnosti zákazu komunistů ??
    Tak snad marťani….

  378. 439- neprskejte, šimone, já také nehodnotím vaši osobu…vono svádět všechno na Wendu Hafela fakt nejde. Jeden si leccos pamatuje.

  379. Zkuste si to přečíst pořádně – nešlo jenom o toho Wendu….
    A to vyprsknutí bylo smíchy…..

  380. martine kdo poslouchal pravnika blazka jak presne voli slova co mu rekl koudelka- musi vedet ze byl koudelka u pripravy amnestie 😀

    ono nekdy kdyz nechteji pravnici lhat tak voli tak presne krkolomne vyjadreni ze je jasne ze vse ostatni se stalo

  381. No je to takové hezké Andy…bejvalé politikové, členové stran, se teď bijou v prsa, když už jim nic nehrozí, že ty komunisti jsou fuj a když byli aktivní, tak o nich nebylo ani vidu, ani slechu….
    Ale to je normální, nic jiného od nich nečekám.

    Ten Tomášovo článek se mi docela líbil. Ostatně příspěvky o tom, že kdo nežije v kotlině, nemá co kecat, se objevujou tady taky, i když sporadicky o poznání méně častěji, než na Novinkách….

  382. tedy nehrozilo jim nic ani tehdy, snad jen to, že by se navrh zákazu a další postihy ve vztahu komunisté a stát začali líbit více a oni je museli nějak prakticky „udělat“ 😀

  383. Moje máti nechtěla volit okamůru,protože prý je napůl cizinec. U knížete, který má je taky napůl cizinec, jí to nevadí a papouškuje všechny nesmysly, kterým jeho fanoušci krmí veřejnost.

    TAk se v tom vyznejte… Ostatně v případě máti jsem ráda, že se těší takové duševní svěžesti, že ji ty volby ještě vůbec v jejím věku zajímají, jakkoliv jsou její argumenty poněkud mimo.

  384. kterým jeho fanoušci krmí veřejnost.- například?

  385. no jo, už se těším, až bude prezidentem Zeman (Lesník) dvojitá duha se rozeklane a národ bude šťastný. Úplně to didím v barvách technicoloru 😀

  386. Andy, jakejma, to je přeci jedno, duch blogu musí být zachován a stará parta táhne za jeden provaz. Takže dřív bylo…pan prezident Klaus má vždycky pravdu, teď je to téma, Lesník a jeho špinavý, špinavý…. špatný vliv na kotlinu, příště bude něco jiného. V podstatě se nejedná o nic mimořádného, stará parta imperialistům nenalévá.

  387. třeba že je nezatížený žádnými kostlivci této vlády, že dosud za žádné průsery neodpovídal a tak…..prostě dočista dočista…..
    Jo a taky samozřejmě netrpí stihomamem, že ten druhej křupan a Klaus jsou komplotisti atd…..

  388. 452- ale ne, jirko, na tohle já nehraju. Jen mne zajímají ty nesmysly, zatím to vypadá, že se KS jen brání útokům, i když ti nacisti a emigranti se fakt povedli.

  389. Andy, jasně, taky si myslím, že to s tou starou partou je pitomost, ale znáš to, nešlo odolat….Na druhou stranu, už jsem psal, že mne bude těšit, že když Zeman něco udělá, co se mi nebude líbit a napíšu to zde, tak se ihned ozve spartááááá. Což by mi chybělo a nerozuměl bych odezvě, protože na souhlas nejsem zvyklej 😀

  390. K volbě prezidenta budu mít jenom jednu poznámku (víc doufám ne):
    Dosud mi byl mírně sympatičtější Lesník – nikoliv však natolik, abych ho volil. Po jeho hlášce o komp(l)otu K+Z se v mých očích sundal na stejnou čáru s Křupanem.
    U mě to je tedy zatím nerozhodně, asi jako jestli si mám vrazit rezavej hřebík do levý nebo pravý nohy.
    Nevidím dosud důvod jít ani jednoho volit.

  391. Tak snad kdyby mi ještě někdo vysvětlil, jaký politický důvod vládu k tomu nákupu vedl?

    …„Je to naprostý nesmysl. Rozhodnutí o pořízení letounů CASA bylo rozhodnutím vlády. Policie nemůže jednoho člena vytáhnout a obvinit ho, protože šlo o politické rozhodnutí. Byl by to jedinečný precedens, kdyby jeden člen vlády nebo všichni byli obviněni kvůli politickému rozhodnutí,“ řekl (Schwarzenberg) loni v červnu…
    http://www.novinky.cz/domaci/290750-kvuli-kauze-casa-vypovidal-schwarzenberg-na-policii.html

  392. 459: Rputi, za to může Klaus, už to na novinkách nebo idnes psali.
    Byl by to dobrý precedens, pokud vláda kryje podvod a lumpárnu, tak je postavit před soud. Snad je parlament vydá ke stíhání, když vydali Bártu. Píši „pokud“, protože nevím. Nejlépe by udělali, kdyby všichni ministři té doby požádali o zbavení imunity a očistili se před soudem 🙂 Kdo nic neudělal, nemusí se přece naší justice obávat.

  393. Napsal bych vam co zpusobyl kandidat na presidenta na Islandu, tvrzenim ze existuji letajici ryby ( islandsky areo rybuee) nestacil ani preplavat fjord a musel emigrovat do Danska!!! Ale pocitam ze by se to obratilo proti me, tak toho radsi necham . . .

  394. Brouku, když Vás tu tak vidím, slyšel jsem, že jste si založil stáj speciálně pro koně určené na výrobu smyčců pro vídeňské filharmoniky. Nepředpokládám, že to je nějaká pomluva, protože to by bylo velmi šklivé, ale tím směřuji k mé otázce, uslyším smyšce již na letošním plese, Nebo snad až příští rok?

  395. Jíirko, andy, přestaňte blbnout.

    Napsala jsem jen, že mojí máti, paní ve věku 88 let nevadí na knížeti totéž,co jí vadilo na Okamůrovi. Připadalo i to jako docela názornej příklad, jak je to s argumentem, že někdo není Čech.

    Pokud jde o nesmysly, tak komploty Zemana a Klause a jak si mohl mladej Klaus dovolit urazit knížete a jak ho tatínek dosadil na telé místečko na PORG – Klausovic rodiuna je momentálně pro máti nepřítel č.1, i když byly doby, kdy ho obdivovala. A už se „těším“, jak si vyslechnu, co za mizeru je ten Dejdar, když nepodporuje knížete a že dobře mu tak.

    Je to jen pohled do názorů jednoho voliče. Teoretického, protože máti do volební místnopsti sama nedojde a přiznám se, že ačkoliv ji jinak zařídíme první poslední a dovezeme ji, kam chce, i přítelkyni, která k nní chodí na návštěvu brácha vozí domů, aby nemusela autobudem a vždycky si vyslechne, jak je důležitý toho knížete volit, aby to tu neuchvátili komunisti, vyslechne, tak odvoz k volbám jsme ani já ani brácha nenabídli.

    A vůbec to nebylo o tom, jetsli je nebo není kníže dobrej nebo špatnej.

    Možná byste si měli připustit, že některý lidi prostě toho Zemana volit budou a třeba ani ne z nějaké lásky ke komunistům, ale protože kníže jim vadí víc. Nebo lidi, co se na něj nalepili.

    Jirko, zřejmě trpíš představou, že kdokoliv si dovolí mít jiný nnázor než Ty, je sparťan. Musím Tě vyvíst z omylu, já nejsem sparťan, neb se o fotbal nezajímám.
    Ostatně jetsli Losna nebo Mažňák, je mi taky šumák.

  396. tucnaku jsme na tom skoro podobne.
    akorad mne to dalsi vystupovani ( i cele rodiny VK – tedy az na sestru) trochu prevazuje ze to hodim knizeti ( od ted budu psat jak andy KS protoze se mi nechtelo vypisovat to skarede jmeno 🙂 )

  397. nickname 461 – já jen, že mi nikdo neřek, že plánujeme vojenskou alianci se Španělskem… 😀

  398. No, poruším předsevzetí 🙂 a budu reagovat:
    Pepo 465 – uvědom si, prosím, že je značný rozdíl, jaké dehonestace soupeře se dopouští osobně kandidát, a jaké melou „fanoušci“ (např. rodina VK). Jinými slovy, Zeman neni odpovědnej za Klausovo kecy.
    Tímto si u mě Lesník zhoršil situaci, ničím jiným …

  399. 464 maYdo, to musíte pochopit!
    Babička je vážný politický protivník a Jirka proti ní bude bojovat do roztrhání těla nebo zničení klábosnice. 🙂

  400. Musim vas pane kolego zklamat, nestacili jsme obarvit(Rot-Weiss-Rot) je nepsana povinost, tak snad az pristi rok…..ale jeden nejmeovany rakousky politik si objednal trenky z dotycnych zini, tak budem prece jen zastoupeni aspon takhle(a ano zkusil jsem ,a prijemne kousou)……

  401. Rputi,

    já mám dojem, že babička s Jirkou politický názor sdílí. 🙂

    Je to knížecí fanynka. Zrovna tak jako její přítelkyně. Jsou schopný si navymejšlet úplný nesmysle – viz hláška typu “ co si to ten mladej Klaus dovoluje, tatíček ho upíchl ve škole a on si teď o sobě moc myslí“.

    Nojo, babky nejsou dědkové, aby drbaly o fotbalu, tak mají volby.

    Ale myslím, že až jí povím, že jsme dceři koupili společenské šaty a že se chystá do tanečních, zapomene na veškerou politiku. 🙂

  402. tucnaku to mas pravdu.
    ale mi se nelibi ani jeden a volit pujdu.
    koukam tedy i na vyjadreni okolo zkousim to tak nejak hledat komu na cem zalezi

  403. Hmm, tak volební tým Zemana vytasil na Schwarzenberga hákové kříže. 🙁

    To už fakt všichni přehání.

  404. Tak to je škoda Brouku. Ale nevadí, budu se těšit tedy na další rok. Sice mne trošičku vadí, že ten „box“ si nemohu, jako nečlen monarchie, dovolit objednat přímo, ale znáte to, nastrčil jsem kolegu, který má správný původ, který mi to zařídil, tedy doufám, že to udělá i na příště.

    Ty žíněné trenky je asi vyšší vývojový typ, než ty původní kopřivové, přišel jsem na to?

  405. Pavle (473), hlavně se mi líbí, jak zastánci přímé volby tvrdili, že to nebude taková žumpa jako v patlamentu …

  406. No já se právě té mnohem větší žumpy bál. Ale že to bude až takový hnus ?
    Tak nějak jsem si myslel, že volební týmy kandidátů na presidenta republiky budou mít alespoň elementární slušnost.
    Z obou stran je to neuvěřitelný humus. 🙁

  407. Prisel jste na to pane kolego naprosto presne.
    Co se tyce „loze“ klidne se name obratte, mam abanomo do roku 2020 ,a byla by to myslim prijemnszmena povsech tech prestarlejch peinceznach,a hrabatech . .
    Jeste me ,pane kolego prozradte co me to napadlo, psat na blogy natelefonu ?! Asi jsemchtel bejt zajimavej . . .

  408. pánové, já jsem rád, že existuje přímá volba prezidenta, stejně tak bych uvítal i další přímé volby a to včetně místního šerifa, či referendumů, jaká jsou ve Švýcarsku. Vono se to samozřejmě srovná a ještě pár desítek let a bude to férovější.

  409. hřebejk si stoupl za dejdara
    doufám, že umělci umí za ranní rosy střílet ostrými
    když jich bude polovina, stále jich bude dost

    a přestávám číst diskuze, protože za všechno můžou pražáci
    zemanovci nadávají
    schwarzenbergerovci nadávají
    kdo se nás zastane?? PI

  410. 481
    pokud vyhraje kníže, žádná švýcarská referenda nebudou, neb je výslovně odmítl 🙂

  411. hmmm,
    soudím, že naškrobit takové žíněné trenky, aby měly puky, nebude jednoduché. Předpokládám, že tajemství škrobení žíní bude v rodině Herr Woracka z otce na syna děděno jako dědičný úřad škrobitelů žíní už od doby Ferdinanda I. Habsburského. Tuhle jsem v auerspergském rodinném archivu o tom našel zmínku. Povozník Herr Woracek nedaleko Dolního Dvořiště probodl naškrobenou koňskou žíní najatého vraha ohrožujícího císařský majestát Ferdinanda I. právě když se Jeho Výsost za křovíčkem připravovala na celní a pasovou kontrolu v Gmundu. Vděčný vladař jej na místě pasoval na dvorního škrobitele žíní s dědičným titulem k. und k. HofAmylMeister a vzal jej s sebou do Vídně.

  412. 2 Pavel Kořenský – ad 469 – ale musíš uznat, že je ten Stránský takový zásadový člověk, učiněný demokrat, který si za všech okolností stojí za tím, co řekl.
    Vzácný to charakter… Ryzí demokrat a opora občanské společnosti!

  413. Jirko – jasně. A přiznivci jedné strany dostanou červeně natřené kriketové pálky a příznivci druhé strany modře natřené. Po pár referendech či volbách tu nebude nikdo, kdo by volil 🙂

  414. 479- u mně ještě pořád převažuje zhnusení nad poslední nepřímou volbou prezidenta- výhružky, extrémní lži, poslušnost při hlasování kontrolující Jacques a psychopatické výbuchy senátorů o kulkách v poště.

  415. pane kolego, …. není to telefonem, ale tabletem, jehož jsem nadšený uživatel a beru ho většinou všude sebou, když musím z kanceláře, nebo když mám rozdělanou práci a nechce se mi přepínat obrazovky…
    No a pokud bude zpívat u nás vás v Opeře jeden můj vzdálenýej známej , od P, než tedy poletí za moře, doufám, že jsem nic neprozradil, nemám problémy se tam dostat, ale ples je holt ples, to je našlapanější.
    Jinak vy jistě víte, jak je to s tím dalším plesem, jak to pracovně nazývám ..dortíčkovým, který je ihned po tom velkém. Má cenu na něj zůstávat? To víte, v mém věku a manželčině stavu, jestli dvě noci za sebou protančit, není příliš.

  416. PeSi – jo, ten rozhovor je takovej, jak by řekla mladá „dost hustej“. 🙂

  417. Pavle, bohužel musím oponovat – červenopálkaři budou neoprávněně zvýhodněni, protože oběma stranám poteče červená 🙂

  418. Správná poznámka. Tak dobře, žluté kriketové pálky.

  419. hele anemůžou mít všichni stejnou barvu? Vždyť by to bylo levnější, množstevní slevy a tak….ono by to přeci bylo úplně jedno 😀

  420. 469
    ten rozhovor je fakt hustý
    kam se nám ti demokrati(čerchmanti) schovali?
    jsou demokraty jen do doby, dokud mají ostatní shodný názor.

  421. ad 490 -nevěřím! Jedné straně musí téci modrá… 🙂

  422. LOL:

    Tý – Bolek, koho volíš ?
    – Knížete, né. Cos myslel, vole ?!?
    Tak tu máš Othella aji Desdemonu. Bo ti dva šulíni co je hráli, volí Zemana.
    – Tý vole, já nemám kozy – jak mám hrát Desdemonu ?
    Něco vymyslíš, vole. Se zeptej třeba Lábusa….tý, Bolek – koho vlastně volí Lábus ?
    – Zemana nebo Schwarzenberga – jeho postoje sú dosud nejasné.
    Bolek, zajdi za Lábusem, domluv s ním ty kozy a nech mu podepsat totok prohlášení šlechty. Zítra to chcu mít s podpisem na stole… a tebe s kozama v Národním.

    🙂

  423. Jirko – stejný barvy ? No to by teda rozhodně nešlo, to by se na dálku nepoznali. 🙂

  424. No jo, modrou kref jsem nedomyslel …
    Tak bude asi nejlepší varianta 492 – všichni stejně a pálky (s trikolórou) budou díky množstevní slevě třikrát dražší.

  425. pánové, nic proti žíněným trenkám, ale pokud vím, žíněnou košili nosili kajícníci, aby odčinili hříchy svoje i světa. Kajícný efekt způsoboval fakt, že taková košile neustále škrábala, takže nositel neměl ani pomyšlení na darebnosti.

    ale nakonec, Jirkoa asi ví, zač se chce kát 😀

    mimochodem, Jiří? Jak to „při manželčině stavu“ ? To už zas?

  426. no jirko referendum , prima volba , divadlo , hnus.

    no ja jak se tak v noci pretacel a potil se ( asi to tomu dost pomohlo) jsem celou noc poslouchal projevy poslancu pri pokusu sesadit vladu.

    myslis ze ti zvoleni jsou na vyssi urovni nez ti co voli ?

  427. Tady je pane kolego kazda rada draha. . Ja sam se ridim heslem, prislo to odnekud z arabskeho sveta, „Na novy bal, s novou manzelkou“ . .je tosice ponekud narocnejsi na logistiku, ale ma to svoje urcite kouzlo, ze ?

  428. No ja to vidim tak, ze mezi zinenou kosili a trenkami je urcitz rozdil. Kosile -pokani,
    . . trenky, rekneme konicek, nebo tak nejak . . .

  429. tedy Brouku, já jsem konzerva, když jsem jednou už řekl ano, tak to nějak doklepu. Je to větší dobrodržství, na druhou stranu, doma samozřejmě schovávám nože, jako každý, že…no a stím plesem jste mi tedy neporadil, nějak se nad tím tedy budu muset zamyslet sám….

    Pepo, samozřejmě že ano, jsou ti nejlepší nejlepších…vždyť je zastupitelská demokracie, ni?

  430. No pane kolegu, a coz zkusit misto manzelky myze? Podivdnte Elton Dzon, ceka druhe dite, sikulka. . .a to ani nema delohu!
    Navic to ma vyhodu ze pokud jedete na bal do vzdalenejsi obce, nemusite tak casto stavet na curani. . .

  431. Ackoliv, uz jste pane kolego videl zenu v balove robe jit u silnice na malou? To je pane kolego multitasking! Nektere casti odevu, pokud jsem to dobre pochopil jdou „dolu“, jine naopak nahoru! A nesmi se to poplest. To je dost dulezite…..je to trochu neprehledne . .no nechte si to jeste projit hlavou . . . .

  432. Brouku, co si budeme povídat, netuším vůbec o čem mluvíte, nenosím totiž ženské šaty. Stejně by mi to moc neslušelo, zvlášť když si nechávám někdy narůst strniště, že. A na svatou Kateřinu rozhodně nevypadám

  433. No tak jo, tak o tom budu uvažovat, když že má Elton čas?

  434. No nechci vas do niceho nutit, ale pucte si aspon nekdy manzelky zupan sednete si pred televizi dejte si nohu pres nohu a uvidite naprosto jiny svet. . . Ale to uz asi zachazime moc do detailu a skoro odbocujem. . . A co rikate, pane kolego na primou volbu presidenta. . . . .

  435. nechci vam tu moc zasahovat do uplne jineho sveta 😀

    ale ted jsem si precetl jak klesa kriminalita.

    trochu mne prekvapuje ze se deli na majetkovou a hospodarskou. jaky tam je rozdil?
    jestli to dobre chaqpu tak to je rozkradani socialistickeho vlastnictvi 😮

  436. Brouku, co bych ríkal, jsem nadšený….

  437. tedy, byl bych, kdybych byl stoupencem parlamentní demokracie 😀

  438. Jirko, parlamentní demokracie an sich problémem není, problémem je všeobecné rovné volební právo.

  439. Dobrý večer, zprávy naše krásné, veřejnoprávní, také zamlčeli návrh pana Schwarzenberga poslat vládu i prezidenta do Haagu. Hlavně že jsou vyvážené.

    Napadlo mě, nechtěl tam poslat i Madeleine s Václavem a Hasimem?
    Nebo to myslel tak, že kdyby tchán vyhrál, tak by všichni měli provaz … ale to už přeháním.

    Kdyby se byl býval pan kandidát omluvil za hloupost co vyslovil, nemuselo by se to rozmazávat a měl by šanci vyhrát i mimo Prahu.

    Zeman by měl zpomalit, někdy ve čtvrtek to bude gradovat, tak aby byl připravený.

  440. No az vam, pane kolego, nekdo bude vypravet jakajetopohoda tyhle moderni telefony, tak ho zente bicem!
    . . Dobrou. . . 😉

  441. Brouku, užijte si zbytek víkendu…

  442. (255) Souhlasím, hlavně s tím „ale“, jen nechápu tu Tvou mánii zakázaného z (256).

  443. (278) některé díly toho seriálu jsem zahlédl. Aniž bych chtěl bolševíky obhajovat, některé ty projekty byly „zašlapané“ zcela důvodně. Mašíbl je apolitický.

  444. (308) „pater“ se nebojí, „bojí“ se ti, kterým to politicky pomáhá. Ta hysterie kolem funguje spolehlivě.

  445. Tak režisér skvostů jako „Parta hic“ kádruje Dejdara za podporu Zemanovi… To bude tedy ještě hustý týden 😉

  446. Dobrý večer vespolek,
    běžkování bylo skvělé.
    Koukám politický cirkus se mění v žumpu, takže asi bude nejlepší si na dobrou noc zkouknout detektivku na BBC1 posazenou do doby Jacka Rozparovače s názvem „Ripper Street“ 🙂

  447. (360)„Takze jestli by nebylo lepsi se orientovat na neco jineho, treba prave na to vetsi spolecenstvi, kde budou narodove zit ve svobode at si rikaji jakkoliv.“
    Jistěže by to bylo krásné. Jen nevím, kdo ty zaostalé Němce přesvědčí, že to obnáší i placení řeckého (ne)způsobu placení daní a francouzské obliby dotací a stávek, Čechy, Holanďany….. o výhodnosti placení téhož. Dekrety (pardon směrnice) z Brusele to asi nebudou.
    Větší společenství by mělo něco spojovat. Co?

  448. (397)“ a budu se srdečně smát, až Jeho Jasnost bez mrknutí oka jmenuje vládu s komunisty. Zaorálek se Sobotkou jsou proevropští a komunisté jsou i v euparlamentu.Jsme přece demokrati.“
    Což by Zeman zaručeně neučunil …..
    😛

  449. (439) A kde vidíš tu pravici, tedy vidíš bez lupy?

  450. (479)„Tak nějak jsem si myslel, že volební týmy kandidátů na presidenta republiky budou mít alespoň elementární slušnost.“
    Měly by, pokud by většina voličů nebyli pitomci. Cíliti nutno na největší voličskou skupinu.

  451. (500)„myslis ze ti zvoleni jsou na vyssi urovni nez ti co voli ?“
    Proboha, proč?
    Proboha, jak?

  452. (514) Jestli ono to není, nickname, jako s Klausem a „neznám špinavé peníze“. Dodnes se na tom kdejaký pitomec klouzá, a přitom ve své době a nezkreslený to byl výrok zcela správný a přesný.
    Pokud Schwarzenberg tvrdí, že v dnešní době by Beneš s celou vládou pelášili do Haagu, má, vzhledem k tomu, že nejsme velmoc, která si zákonitě může dovolit více, nejspíš pravdu.
    Nenajde se lepší klacek, kterým by ho bylo lze mlátit?

  453. Ad Stránský, docela starého pána chápu. Nic nedemokratického nedělá, vyslovil svůj, IMHO dost odůvodněný názor.
    Mně se Zeman také ekluje.
    Dost přesně to vyjádřil Macek: Jednoho kandidáta volit nemohu, druhého nechci.
    I já.

  454. Já Zemana, Karle , taky nemusím, ale na druhou stranu, prásknout dveřmi a udělat kříž nad někým, kdo jen volí někoho jinýho, než se mi líbí, to taky není nic moc,
    Když si lidi tu politiku berou tak, že činí monumetální prohlášení, že s tímhle darebákem už nikdy, jen proto, že má jiný názor než oni, z toho obvykle nevzejde nic dobrého.

    Mimochodem, mravní rozhořčení Bočana, režiséra v normalizační TV a takových veleděl jako Parta Hic nebo seriál Druhý dech- „seriáll o chovu krav, plnění plánů s nimi spojených a lidech, žijících úspěchy a obtížemi živočišné výroby od počátku 70. do druhé poloviny 80. let minulého století“ (čsfd) – nad tím, že si Dejdar dovolí volit Zemana, se mně teda ekluje víc, než celej Zeman.

    Je to pěknej cirkus, ta přímá volba. Očekávám, že koncem týdne budou fanočšci obou pánů chodit vytloukat protistraně okna a čmárat neslušný nápisy po zdi.

    Možná by nebylo od věci prezidentský duel místo debat pojmout tak, jako v Šíleně smutné princezně naložili s válkychtivými generály : Hodit je do bahna a ať se v tom porochňají a poperou 🙂

  455. Nezapomínej MaYdo, že se to k Tobě dostává vše prostřednictvím médií.
    V odkazovaném článku dokonce Stránský říká, že jeho názor nebyl pro média určen. Mám prostě pro starého pána pochopení a nezapomínám na možné změny během cesty od něj ke mně.
    Bočana jsem nekomentoval, neznám, je mi jedno.

  456. jen taková technická
    pokud názor stránského nebyl určen pro média, pak to určitě neměl sdělovat právě urbanovi. i když v tomto případě dále popisuje, že se ho urban ptal, jestli to může zveřejnit

  457. >> divana
    Že by p.Stránský netušil nic o kvalitách p.Urbana?

  458. Jeslti by nestalo za to vytvorit ministerstvo pravdy, kde se proste bude upravovat minulost, podle toho, jak se velky bratr vyspi a jak bude situace , predeslo by se tim mnoha nedorozumenim a trapnym stavum. Na druhou stranu, je to asi jedno, protoze Spartaaaaaa

  459. Dobré ránko!

    K článku pana Mánerta lze říci jen to, že je napsán velmi účelově.
    V.Klaus u příležitosti výročí německé okupace 15.3.2003 řekl:“Klaus ve včerejším prohlášení u příležitosti výročí obsazení Československa nacisty 15. března 1939 uvedl: „Tyto události plné násilí a lidských tragédií poznamenaly celé generace a pocity křivd v myslích řady lidí přežívají dodnes. V České republice i v Německu bychom měli umět říci: Toto se stalo, dnes už minulost nezměníme, z dnešního hlediska šlo o činy nepřijatelné.“
    Zdroj: http://zpravy.idnes.cz/klaus-oznacil-odsun-nemcu-za-neprijatelny-fi9-/domaci.aspx?c=A030314_225057_domaci_jak

    Žádné vyhlášení o neplatnosti dekretů to neobsahuje.
    Stejně tak i Zeman řekl jen to, že jsou právně vyhaslé.
    Což je to, co tu říkáme i my.

    Jediný, kdo vyhlašuje, že dekrety neplatí je KS. A sudetští Němci, pochopitelně.

  460. 531 – jednoho nemohu, druheho nechci. . .
    Tak prave kvuli tomu druhemu se přemužu a pujdu volit; mozna ma smulu (ale jenom trosicku) ale nechci moc videt vsude exhibovat fašistoidni stoupy, kteri ted v mediích a okolo nej řádej jak utrzeny vod retezu.
    Denuncovani kvuli jinemu nazoru, nezrizena adorace kazdeho Jeho prdu, prekrucovani Jeho křivaren, trapne prvoplanova ocista od vsech Jim provadenych kurvaren, atd.
    To ministerstvo pravdy uz funguje v plnem nasazeni az moc schopneho Kalouska. . .
    Takhle rozdane karty stojej za hovno, takze neni o jakoukoliv moznou vyhru co stat, nicmene budu mit aspon pocit, ze jsem neco malinkeho udelal pro sebe.

  461. No a 538 to jenom potvrzuje. . .
    War is peace. . .freedom is slavery. . .
    Ty fašouni se se svyma metodama vubec nezmenili.
    Zato maj nejak vice stoupů v posluchačstvu. . .nejen tady.

  462. Hlasování KS:

    …Když šlo ovšem o něco podstatného (posuďte sami s jakými důsledky), našel si čas i na hlasování jak v senátu, tak v poslanecké sněmovně. Jako senátor stihl hlasovat například pro Lisabonskou smlouvu, nebo zákon o podpoře obnovitelné energie, zatímco v senátu chyběl vždy, když se hlasovalo o čemkoli, co bylo navrženo proti legálnosti KSČM. Jako poslanec zvládl zvednout ruku pro církevní restituce, odklonění peněz v rámci tzv. důchodové reformy do soukromých fondů, zvýšení daní, nebo pro Rozhodnutí Evropské rady – změnu čl. 136 Sml. o fungování EU, tedy pro tzv. trvalý záchranný mechanismus eurozóny (ESM). ..
    …Z pozice ministra zahraničí přitom prosadil v březnu roku 2011 při jednání NATO naše hlasování pro vojenský zásah v Libyi a několik let před tím, v roce 2007, hlasoval na zasedání Valného shromáždění OSN proti návrhu, který měl za cíl omezení dopadů použití zbraní a munice z ochuzeného uranu. Uznání Kosova a postavení se tím proti jednomu z mála národů, Srbům, který stál historicky na naší straně, to je jen další z mnoha podobných kapek…
    http://frantisekmatejka.blog.idnes.cz/c/316307/Karel-Schwarzenberg-Lesk-a-bida-kurtizan-po-cesku.html

  463. Mne tak nešlo ani o p. Stránského, jako o p. Bočana. Ten skutečně za socialismu trpěl jako kůň, takže ten má na blbé kecy nárok.
    Když tedy odhlédnu od toho, že Maděra na konci páté série umřel (nebo ne?) a musel by vstát z mrtvých jako Bobby Ewing, aby seriál mohl pokračovat…

  464. vubec nerozumim, proc se vseho tak bojite, vzdyt vyhraje Zeman.
    Treba uz pristi tyden opustite hlubokomyslne rozvahy o nutnem zlu a o nepratelich a vratime se zase k obvyklym zpusobum a minutam nenavisti, jako jsem byl zde zvyklej. ostatne ne nadarmo jsem videl vcera obrazek Barta Simpsna , jak pise na tabuli pod sebe….. Milosi a Karle, bezte uz do prdele.
    Na druhou stranuje zajimave, jak lidi blbnou.

  465. 539-snahu o vyváženost u médií člověk nečeká, ale poslední dva týdny jsou fakt mimořádné. MF, LN nebo HN mají na titulce denně několik článků o kauzách MZ, a k tomu pár oslavných ód na KS. A zdá se, že KS nikdy nerestituoval, neprivazoval, nic neříkal, on je dokonce v té dnešní vládě náhodou.
    A když náhodou někdy spí, žvatlá nebo řekně nějakou koninu, je to takové roztomilé a rozkošné a milučké…
    Co je zvláštní, těžkou protizemanovskou ofenzivu vede i slovenské SME. Skoro to podle SME vypadá, že se bude volit slovenský, ne český prezident.

  466. NoName, ony jsou natočené jen 4 serie, pokud vím. Ale Stránský se už nechal slyšet, že pátá serie se dělat nebude.

  467. 545-aha, tak to byla čtvrtá … No v každém případě se mi zdá, že Maděra v posledním dílu umřel, spadl z koně a už se nedočkal narozek s Havlem.

  468. 543-no třeba koncesionářské poplatky platí i nevoliči KS, tak snad se aspoň rozčílit můžou, ne? 😉

  469. 530 Dobrý den, Aerokarle, kdyby novináři z ČT, ČRo odvedli svojí práci a citovali výrok pana kandidáta celý, mlčel bych, ať si každý udělá názor. Toto nedělají a jejich kolegové v jiných novinách povídají hlouposti po nich.

    Ad dekrety: všechny dekrety, co jsem četl, byly socialistické svinstvo. Celá politika pana Beneše od roku 1938 byla taková … socialistická. Volby 1946 byly cinknuté. Všechno bylo špatně. Ale pořád to bylo lepší než hromadná sebevražda pod Adolfem.

  470. rozhodne se vsichni muzeme rozcilit a hadat se az do aleluja. 🙂
    jen je potraba si tak nejak dopredu stanovit, kdo je nastvan opravnene a kdo je fasista, aby v tom nebyl binec

  471. Nickname, sleduji několik stránek ohledně RU monarchie, a je zvláštní, že když dojde na Beneše, jde veškerá slušnost stranou a hlavně maďarští milovníci starých časů dští síru na všechny strany.
    Přitom Beneš nedal zavřít ani jednu maďarskou školu, nerušil spolky (na rozdíl od Maďarů v kterékoliv historické době)… A četl jsem hromadu vzpomínek občanů ČSR maďarské národnosti, kteří byli šokováni primitivismem přicházejících maďarských důstojníků a úředníků po obsazení pohraničí. Prý dokonce v Komárně po obsazení Maďary svítil na mostu velký nápis „za Beneše jsme chodili v hedvábých kalhotách, teď máme holé prdele“.

  472. 550 Kalhoty byly československé, ale ty holé zadnice, ty byly jejich 😉
    Jirko, vy jste partyzán nebo fašista? 😉

    Já úplně nechápu milovníky toho či onoho historického období. I toho RU. Chtěli by Maďaři obden Villágoš? Nebo Rakušáci hlídat Bosnu? Češi do Haliče?

    Každá doba má plusy i mínusy, tak si udělejme dnešek a zítřek tak, aby se nám co nejvíc líbil. Konec kázání

  473. Nickname-když ono je to takové zvláštní. V maďarské televizi nebo novinách je každý den článek o útlaku Maďarů na Slovensku-přitom na Slovensku můžete přežít celý svůj život bez toho, abyste řekl jediné slovenské slovo. Vím to, protože moje babička v životě nic slovensky neřekla. Prodavačka se s váma domluví, doktor taky, na úřadě taky. V knihovně mají maďarské knížky, existuje komplet školství od školek až po VŠ…
    V Maďarsku po 60 letech jejich super národnostní politiky ze 700 000 Slováků nezbyli žádní.
    Přesto se teze o útlaku Maďarů opakuje pořád dokola.

  474. zdravím ! To, že přímá volba prezidenta vyvolá stav „kolektivního nevědomí“, tj. že se budeme brodit ve stoce, bylo každému racionálně uvažujícímu člověku jasné od chvíle, kdy tento návrh poprvé byl vysloven 🙁 Stejně bylo jasné, že mediální žumpa bude páchnout více než jindy 🙁 Mne tedy ale překvapili kandidáti, od nichž jsem čekala přece jen jistou úroveň ! No, alespoň vím, jaký který kandidát skutečně je, když odpadne mediální pozlátko 😕
    OT: Dovolím si obrátit pozornost zdejšího publika na stejně třaskavé téma (kocour se činí ) 😕
    http://neviditelnypes.lidovky.cz/amnestie-smel-nepodepsat-0hm-/p_politika.asp?c=A130118_220826_p_politika_wag

  475. 552 Ani v Bekéscsabě? Nagylak už je v Rumunsku, ten je slovenský dosud, i když hodně mladých utíká do světa.

  476. Ajtakrajta. Myslel jsem Nadlac. Ten je v Rumunsku. Nagylak je o kilometr dál, tam situaci neznám 🙂

  477. Pár profesionálních Slováků samozřejmě zůstalo, nickname. U naší rodiny v Nyíregyházi (dědův brácha) uměli staří slovensky všichni, z mladých už nikdo. Maďaři argumentují tím, že je to přirozená asimilace. Nic proti, ale proč jim pak tak vadí přirozená asimilace na Slovensku ? I já mám maďarské příbuzné, kteří dali děti do slovenských škol-šance uplatnit se je daleko větší než když se člověk nedomluví pořádně slovensky a je omezený na jih Slovenska nebo na fabriku Nokie a Samsungu v Maďarsku v příhraničí.

  478. NoName – 552 – Samozřejmě, že jsou utlačený, když přišli o „Horné Uhry“… 🙂
    On je to stejný syndrom jako u Rakouska, jen si to tak neuvědomujeme. Prostě ten rozpad neunesli oba dva státy.

  479. Ale oni o nic nepřišli, můžou dojít, kdy chtějí, Rputi. A taky chodí. Lyžovat, na turistiku… I přes veškerou propagandu jsem viděl maďarské nápisy a ochotu domluvit se i na Donovalech nebo v Terchové.

  480. http://www.krestandnes.cz/article/gabriela-kabatova-amnestie-dava-falesna-kridla/21917.htm

    Kritika amnestie po křesťansku. Amnestovaní se nestihli připravit na výstup, proto je rychlost amnestie chybou.
    Dovolím si k článku komentář: Na náš okres připadalo asi 60 amnestovaných, z nich možná až 30 skončilo na ulici. Loni jsme ukončili činnost jednoho „azyláku“ pro 12 mužů, nespustili jsme zařízení – včetně „resocializační dílny“ pro cca 24 mužů. Kdyby úředníci měli zájem na resocializaci vězňů, recidivistů, mohlo být o ně postaráno. Nechtěli, nemají.
    Kdybychom nemuseli platit daně za to, že pomáháme lidem „na okraji“…

  481. NoName 558 – ale není to „jejich“. Je to jako při rozvodu, kdy se už i nakonec hrnečky dělí na půl, ale stejně má každý z manželů pocit, že byl poškozený a dostal míň. Za to, jak se rozdělilo Československo je opravdu třeba Klausovi a Mečiarovi vřele děkovat, jinak jsme si zadělali na nesmiřitelného nepřítele na 1000 let dopředu.

    A v tom vězí i nebezpečí nekontrolovatelného rozpadu Eunie. Že namísto věčného míru, se budeme nenávidět víc, než kdy před tím.

  482. http://www.finmag.cz/cs/finmag/kaleidoskop/schwarzenberg-je-cesky-obama/

    Kandidát tak (možná vědomě, možná nevědomě) komunikuje, ke kterým společenským vrstvám se hlásí. A funguje to. Vyšší třídy jsou tak posedlé myšlenkou odkázat nižší třídy do patřičných mezí, že jsou ochotny akceptovat v zásadě cokoliv. Pražští advokáti, manažeři a úředníci se v tom neliší od newyorských. Je český Obama. Se všemi důsledky takového stylu vládnutí.


    Před mnoha lety se v Čechách objevil politik, který pochopil, že nedokáže nabídnout lepší program než tehdejší vláda. Podařilo se mu ale převést celou volební diskuzi na hádku o to, kdo je horší zloděj. Jeho strategie vyšla

  483. Dobré ráno,

    533 Karle, dopis mladýho Klause taky nebyl určen pro media.
    Prostě podpásovky na obou stranách. Blbne se na kvadrát.

    V obou případech především považuju za svinstvo, pokud někdo pustil mediím něco, co pro ně určeno nebylo. Ale když ten Stránský spolu s Bočanem dokument, který nazval Prohlášení, tak to asi mediím určeno bylo, ne?

    A jetsli ne a je to akce Urbana, který jen vydává za „prohlášení“ něco, co si řekli někde u kafe, tak co Stránskému brání veřejně vystoupit a říct “ tohle je Urbanova akce, já jsem mu jen soukromě řekl, že mně Dejdar naštval“.

    Jinak, já taky starého pána do jisté míry chápu. Ale od toho tu máme demokracii, kvůli tomu jsme snad chrastili klíčema na Václaváku a za to byl Stráský v kriminále, abychom mohli svobodně volit podle toho, koho uznáme za vhodného. Nejen bez rizika, že půjdeme do kriminálu, když nebudeme volit jedinou správnou stranu, ale i bez rizika, že naší blízci se k nám otočí zády jen proto, že hodíme do urny jinej lístek než oni.

    Pokud necháme politiku natolik zasahovat do našich životů, půjde to s ní i snámi do deseti k pěti.
    Politika, stejně jako oheň je dobrý sluha, ale zlý pán. Se stejně fatálními důsledky, pokud se tím pánem stane.

  484. jsem si přečetla astona, ten se činí
    a lež je jeho spolupracovník:
    „No a pak přišel Václav Klaus starší s tématem Benešových dekretů“
    fuj!

  485. 557 Prostě ten rozpad neunesli oba dva státy.
    svata pravda.
    a to jak u nas to neunesli rakusaci/nemci ani cesi
    tak na slovensku to neunesli jak madari tak ani slovaci.

    nedivim se jedni prisli o majetky , o rodna mista , druzi o stalete sousedy o pratele spousta o cest

  486. „kdy se už i nakonec hrnečky dělí na půl, ale stejně má každý z manželů pocit, že byl poškozený a dostal míň“

    TAk to je logický, rputi. Ucho má obvykle jen jedna půlka hrnečku a ten, kdo dostane půlku bez ucha, může se cítit právem poškozen.

  487. Pepo, Maďaři nepřišli o nic, pokud tedy opopomineme moc. Maďaři mohli na Slovensko i v době totality, a na rozdíl od Němců byla výměna obyvatelstva ČSR/Maďarsko v zásadě dobrovolná a majetek kompenzován. Jeden můj děda byl Maďar a na Slovensku zůstal (a nebyl sám), druhý byl Slovák a přesídlil z Nyíregyházi na Slovensko (taky nebyl sám).

  488. Noname – pokud vidite tak nepisi zamerne kdo prisel o co !!
    ja tam nezil , jednoho rodineho pritele mam z te oblasti. Byl jsem na slovensku kde jsem se cesky nedomluvil , vim ze spousta rodin nechala deti studovat madarsky a ucit se cestinu aby na vysokou uz mohli do brna.
    Znam ale i nazory slovaku ( i kdyz jak psal martin jsou vetsinou z jinych oblasti )

    je to spis o urovni cloveka a ne o tom zda to je madar/nemec – slovak/cech.

    No nebudu presvedcovat Vas – sam popisujete ze jste pul na pul 🙂 – ale kazdy o neco prisel.

    jo jeste jsme vlastne zapomeli na ten ocase za karpatama – tam taky nikdo o nic neprisel .
    Vidite ti myslim dopadli nakonec nejhur.

  489. nechte už nostalgického vzpomínání na minulost a vraťte se do přítomnosti 😕
    Bože můj, takového psa bych chtěla mít doma ! Náš pes totiž krade peníze jenom z MÉ peněženky (a strká je do košíku ) 😕
    Budu ho muset lépe vycvičit 😕
    pravy.idnes.cz/indicky-toulavy-pes-ukradl-tasku-s-penezi-fg9-/zahranicni.aspx?c=A130121_064429_zahranicni_aha

  490. jak tak sleduji tu situaci s Dreamlinery na zemi, tak v souvislosti s tím, jaké ztráty kdo kvůli nelétání má mě zarazila informace, že jediný, o kom se dočtete že bude chtít kompenzace od Boingu jsou Poláci co mají jen jedno jediné letadlo. Japoncům sedí na zemi téměr celý zbytek dosavadní produkce a místo kompenzací u Boingu hledají lepsí baterky.

  491. Pepo, můj pocit z věci je, že na to, aby došlo k posunu v myšlení, musí jedna strana přestat neustále vznášet NÁROKY. Situace totižto není symetrická, jak by se mohlo zdát. Slováci po Maďarech nechtějí nic, zato Maďaři chtějí omluvu, víc pochopení atd. atd. A to v situaci, kdy užívají nadstandardní menšinová práva, které oni v celé své historii jiným národům nikdy neposkytli.

  492. 572 Noname, pochopte, oni jsou moderní, citliví a byli utlačováni. Hlavně Benešem. A Čechy. Oni způsobili, že sám náčelník vydával zvrácené rozkazy.
    Nevíte kolik je teď v Německu tureckých a ruských gymnázií? Kolik vysokých škol?

  493. Hm, nojo, to jestli tu (či jinde?) někdo psal, že volba mezi Schwarzenbergem a Zemanem je jako rozhodovat se, zda si uříznout levou nohu nebo pravou, pak bych řekl, že si k tomu musím ještě přimyslet, že jedna je chromá, ve druhé mám gangrénu – a potřebuji teprve identifikovat, která je která.

    Situaci dokonale zatemňují mainstreamová masmédia. Podívejte se prosím na tohle: http://brno.idnes.cz/omluva-pani-therese-047-/brno-zpravy.aspx?c=A130121_1879461_brno-zpravy_kol . Přitom bych doporučoval důsledně rozlišovat mezi skutečností, že Brňan je rozjitřen natolik, že tu omluvnou petici sepíše, a skutečností, že mu ji Mladá fronta otiskne na čelném místě. Máte-li chvilku, můžete si to (v archivech, leccos je přístupno i z internetu) porovnat s tím, co zde noviny psaly po atentátu na pana zastupujícího říšského protektora…

    Samozřejmě v tomto světle si člověk představuje, co asi budou tihle lidé pět let psát v případě, že je Schwarzenberg zvolen a vyskytují se politické třenice (což lze jistě očekávat prakticky imrvére, bez ohledu na výsledek volby)… No jo, jenže teď si připusťme, že tato – vskutku veskrze makabrosní – představa v našich myslích zastiňuje a odsouvá veškeré naše odhady, jak to asi může vypadat, bude-li zvolen Zeman…

  494. tak už se píší otevřené dopisy
    kdy přijdou na řadu podpisy pod tresty smrti?
    jen aby to skončilo s touto sobotou

  495. By mne zajímalo, zda je něco, co Břéťa Rychlík nepodepíše.

  496. (577) Klaus prý jako president rozděloval ……
    😛

  497. slyšela jsem to v rádiu, teď jsou dva čekatelé spojovatelé 🙂

  498. Matzurko, děkuji za odpověď 131 na mé naivní otázky. Až někdy nebudu mít co na práci, zkusím si získaná čísla dosadit do ňákejch těch vzorečků, jestli mi z nich třeba cosi zajímavého nevyjde… Ještě bych prosím měl doplňující dotaz: Pro stejně dlouhé barcody je jasné, jak spočítat, v kolika % bází se liší (je to v podstatě totéž jako jejich Hammingova vzdálenost – ovšem mezi dvoubitovými prvky, ne jednobitovými – podělená délkou barcodu, na tom není nic zajímavého). Ale jak je to procento přesně definováno pro nestejně dlouhé barcody? (Samozřejmě mi nejde o ten nestejný jmenovatel, to je trivialita.) Používá se k tomu výpočtu nějaká konvoluční funkce a vezme se její maximum? Ta by taky ale vracela drobet podivnej (tj. podhodnocenej, tak ňák poloviční) vejsledek v (ryze teoretickém?) případě, že jeden barcode je přesnou kopií druhého, z níž však někde uprostřed souvislý úsek bází vypadl…

  499. 576 Státní úředník je rozhořčen … voliči tohoto kandidáta jsou často státní úředníci. Je rozhořčen pomluvami, že otec paní Theresie byl u SS. Není nic snažšího, než tuto pomluvu vyvrátit.

    Proč by úředník nemohl být politicky aktivní, když je aktivní správně, že. 😉

    Čeho nabyl občan pilný, to mu erár rozkrad zpíval Bretschneider.

  500. Noname myslite si ze si to slovaci mysli taky?

    ale at nepokracuji – a vsichni? vestina? politici co se na tom chteji vyvezt ….
    kdyz jsme se delili tak jsem delal pro jednoho vlivneho slovaka – nazory jednotlivcu slovaku na jednotlivce cechy nebyly problem.
    nazory jednotlivcu na skupiny uz byl problem. Oboustrany i kdyz z jedne strany vzdy trochu vic.

  501. 587 Já si myslím, že by k tomu mělo dojít. Jinak je to nepřípustná diskriminace.

  502. kdyz tu ctu nickname o tom medialnim prosazovani jednoho kandidata.
    pripadalo mi to v prvnim kole vic. ale i tak.
    – obe kampane vedou velice dobre dva profesionalni tymy.
    – kazdy z tech profiku ma spousta kanalu jak se dostavat do medii ( tady ma asi KS diky idnes a lidovkam trochu vic)
    – pripada mi ze se “ mluvici hlavy z nasich penez “ snazi brzdit sve preference a pokousi se o objektivitu. Uplne se jim to nedari ale cekal jsem ze budou horsi.
    – trochu mne vykolejila otazka sudetskych nemcu vtazena do teto volby – vratim se k ni pozdeji.
    – hodne mne vykolejila a velice zklamala ucast rodiny VK v kampani pro MZ lepe proti KS. ( to co napsali kejkliri proti dejdarovi je blbost – dost tu vyzvedavana. ze podobne vystupuje rodina prezidenta je mi zklamanim).
    – ta profesionalni kampan ma jediny cil – co nejmene mluvit at pozname nazory kandidatu a co nejvice vytahnout , klidne i lzi ( na obou stranach), to proc toho druheho lidi budou nenavidet.

  503. 589 Pasáčku, rodina VK je … kdyby byli bývali mlčeli, mohli být považováni za filozofy.

    Kdyby byl býval KS neřekl tu hloupost s Haagem, kdyby se držel deklarace, byl by považován za rozumného, takhle ztratil celé pohraničí. Protože tím znejisťuje obyvatelstvo. Nejistoty v právním řádu nejsou potřeba. Kdyby se omluvil, resp. kdyby upřesnil svůj výrok, nemohli by na něj útočit.

    Kampaň KS je útočnější, více využívá facebook, uměleckou frontu, novináře. Zeman sází hlavně na sebe. Zatím jsem neviděl profesionální kydače na jeho straně – kromě A.B.Bartoše a rodiny VK, obojí IMO kontraproduktivní.

  504. ted ti sudetaci
    znovu jsem si to zkouknul tady http://www.ceskatelevize.cz/ivysilani/10483849868-prezidentsky-duel/213411033170117/
    je to nekde kolem 78 minuty.
    podle mne tim chtel zkryte vemeno pomoci KS aby spravnou odpovedi jednou provzdy rekl ze listina prav a svobod neplati zpetne a nebudou sudetaci reseni.

    bohuzek huhla KS navic neznajici rec natolik aby rozlisoval vahu urcitych slov to nerekl zrovna spravne.
    ale ne zase tak strasne.

    tak ale nasledoval pripraveny utok MZ otazkami do minulosti – kdyz je KS zacal odpovidat nabil MZ s tim ze by !! pravdepodobne !! benes skoncil v haagu.
    A pak uz to byla jen klasicka metoda kterou muzete poslouchat denodene od paroubka, ratha, zaoralka , janecka, randaka, drtinove , vemene, krause ….. vsech neni dulezite o cem se mluvi , dulezite je to motat dokola at to vyzni ze ten druhej je lump.

    pokud bych to bral ze tento bod vyrovnaneho duelu byl vlozen kvuli nadrzovani nekomu ( muselo byt jasne ze toto musi vyhrat pred ceskou verejnosti MZ ) tak to bylo ve prospech MZ.

    zkuste si to !!! cele !! poslechnout a reknete mi ( s mensi citlivosti na to ktere slovo) co tam bylo nazorove proti zajmum CR a lidi CR

  505. nickname – ok zapomente na to.
    nemam rad pravdu a lasku stejne jako socialismu s jakoukoliv tvari.
    nemam rad socialistickou evropu ale vic nemam rad rusko
    nemam rad kdyz se moc poukazuje jak ti ostatni moc a ja nemuzu ale kde muzu tak aspon trochu.
    nezlobte se na mne – VK je zatim porad prezident teto republiky a ne kejlir ale kdyz to berete jako kdyby byli

  506. ps ja vubec jeste nevim zda budu KS volit dokonce zda budu volit – hodne mi ten tlak nekejkliru ale posouva hranici ze ano.
    i to je kampan

  507. 592 pasáčku, právě, kdyby KS řekl, asi jsem to vyjádřil špatně, ale smysl byl čs-de deklarace, bylo by to státnické a byl by volitelný. V těchto vztazích jde o slovíčka a musí se vážit na lékárnických vahách. Jenže tým KS rozhodl – omlouvat se nebudeme, budeme kroutit a motat, veřejnoprávní tutlalové nám pomohou a do toho spustíme přehradnou palbu. KS se rozhodl nevypadat státnicky. MZ ho chytil na návnadu a KS se pořádně zakousl.

  508. blbnete taky, někdo tu už dřív napsal, že vtahování soukromých vyjádření do medií delají obě strany. Já se zdržuji komentářů, když mám za jisté, že se informacím nedá věřit.

    Zapomněli jste na počasí – jestli je někdy kurevská zimní slota, tak je to dnes. Na vychlazenou zemi při teplotě kolem tří pod nulou dopadá déšť. Okamžitě zamrzá jako ledovka. To se nedá ani odsolit, ani seškrábnout – je to zimní průser. V autě jsem to cítil jen zlehka, silnice se leskla a tak jsem tomu přispůsobil rychlost a styl jízdy. Ovšem na konci cesty jsem musel vystoupit – Keystone cops hadr. Naštěstí bez konečného pádu a bez zranění a zlomenin. Bylo to v areálu nemocnice a první pomoc by tedy byla na blízku. První pomoc jsem nepotřeboval, ale soustavnou péči tohoto ústavu asi ano. Uvidíme po vyhodnocení.

    Ještě jednu informaci. Temné slušovické nitky opět prokázaly, že Čuba dokázal a stále ještě dokazuje bystrý mozek, schopnost poznat, sehnat a úkolovat schopné mladé lidi.

  509. Svět se zbláznil. Člověk nemůže otevřít noviny, net, dát hovor s kýmkoli – všude se pere špína a útočí na každého,kdo má jen krapet jiný názor nebo nemá názor žádný, podpásovkami a blátivými granáty. Žel bohu i zde dochází k poněkud ostřejší diskuzi – kdo proboha je „stará parta“??? A do toho všeho se tady po včerejším celodenním i celonočním namrzajícím mrholení za okny spustilo krupobití s deštěm. Za hodinu a půl musím vyrazit autmo a docela z toho mám obavy. Koho potkám.

  510. pasáčku 592 – KS ty odpovědi totálně zvoral.

    1)Stačilo říci, že nezodpovídá za to, kdy se raduje B.Posselt
    2) On vůbec neodpovídal na otázku, „zda-li řekl, že by se mělo vrátit….“, ale z vlastní iniciativy naprosto zbytečně začal žvanit o Haagu…

  511. Inu – ad 583 – já jen čekám, kdy vystoupí spravedlivě rozhořčený Jirka a bude požadovat okamžitý vyhazov pro onoho dotyčného úředníka státní správy… Když nám tu tak důkladně zdůvodňoval nutnost vyhazovu Bátory na knížecí objednávku…
    Nehledě na to, že bych od autora petice rád slyšel odpověď na prostý dotaz: Měla madam fotra u elektrikářů? Ano nebo ne?

  512. Nechápu, proč se má za něco, co řekla paní Livie Klausová, omlouvat kdokoliv jiný, než paní Livie Klausová.

  513. Martine, držím pěsti, aby: 1. ta péče byla co možná nejkratší; 2. naprosto stopro úspěšná.
    Nicname – termín už byl, ne? Tak jak? 😉

  514. Ad počasí tenkrát na západě: musel jsem škrábat cca 2mm ledu, jedna bouračka, trochu klouzalo, nic mimořádného.
    Volby mě nechávají chladným, co mě štve jsou ty podpásovky. Potom si autorů hloupostí vážím méně než kdyby mlčeli. Svobodní asi udělali dobře, že ke druhému kolu mlčí. Aspoň budou za ty filozofy. Stejně jde o dva socialisty s lidskou tváří.

  515. 595 – nickname co rekl spatne?
    poslechl jste si to cele?
    vazit slovicka ve vztazich jakych? Toto nema na mezinarodni vztahy vubec zadny vliv. Toho v diskusi se chyti jen populisti.
    ale ja jdu radsi lezet . je to nuda

  516. 601 Dano, čekáme, proto sedím doma přes víkend a píšu hloupostě 😉 Už kope víc a víc, chuděra žena je unavená a spí až do 10.

  517. Dano, to je naše chyba – nevydrželi jsme diskutovat o genetice moc dlouho 🙂 A protože tady nemáme ani ledovku, tak počasí odfláknu slovem hmlisto.

  518. Schválně se teď podívejte třeba na titulku idnes.
    Osobnosti si přejí Karla, Brňané se omlouvají Therese, Klaus a Zeman mluvili stejně a teď to kritizují, Jak žije Karel počas volební kamapaně a jeden řekněme neutrální článek o Dejdarovi. Výběr z blogů-jaké překvapení, téměř všichni za Karla.
    No ano, tak vypadá aspoň pseudoobjektivní žurnalistika.

  519. rputi urcite to zvoral – nabil MZ
    ale to co rekl o poseltovi mne tedy vubec neurazi – prave naopak tam zabodoval.
    proste na blbou podpasovku odpovedel vtipne

  520. Dano,

    ono se všeobecně na západ od nás hodně blbne. Není to geograficky podmíněno, je to blízkostí centra světového dění – bermudský trojúhelník: Hradčany – Podskalí – Karlín.

    My venkovani máme důležitější starosti. Vyjet můžeš, ale dej si vážně bacha. Ty to zvládneš, ale ti blbci naproti ne. Tak s tím počítej před každou zatáčkou i křižovatkou.

    Diskuse tady se nezostřuje, naopak, nadávky se nevyskytují. Stará parta se vymezila sama, pokud mi ten Němec dovolí si vzpomenout, tak to jsou ti komentátoři, kteří mají zásluhy na bývalém a ještě bývalejším Psu a považují to za legitimaci Řádu diskutérů s nízkým pořadovým číslem.

  521. Noname kdyz to se tu porad mota .
    to idnes je soukromej bulvar. Tiskne si co chce.

    pokud muzeme napadat tak neserioznost CT a CRO.

    tedy rict ze jsou hlasna trouba KS rikat muzeme ale vycitat jim to asi ne – delaji si co chteji se svym majetkem.

    radeji doplnim – a neskodi tim nikomu jinemu ktery by nemel moznost koupit si sve bulvarni noviny a psat si v nich cokoliv jineho.

    pokud se ale doposti sireni nepravdy – jsou tu k tomu asi soudy

  522. Takže když v idnes napíšou, že je pepa pedofil, jenom nakládali se svým soukromým majetkem, pepo ?

  523. ano, a právní zástupce pepy s nimi zatočí – v rámci socialistického právní řádu České republiky

  524. ja vedel proc tam radeji doplnim

    – a neskodi tim nikomu jinemu ktery by nemel moznost koupit si sve bulvarni noviny a psat si v nich cokoliv jineho.

    pokud se ale doposti sireni nepravdy – jsou tu k tomu asi soudy

  525. martin mne predbehl.
    dokonce i tim ze mi v ucetnictvi cinkla zalohova faktura 😀

    Noname – martin ma zkusenosti s americkym pravem a vi ze dostat 80 procent z vymozeneho odskodneho neni ku skode 🙂

  526. pepo, jak jde o peníze a vyhlídky na budoucí spor, tak jsou advokáti ti nejrychlejší.

    Jedu domů, budu ležet a nic nedělat. Kdo z vás to má?

  527. Pasáčku, teď jsem si poslechl KS znovu. Odpověděl dobře. Až na drobnou chybičku, kterou mu teď otloukají o hlavu. Měl couvnout, neudělal to. Štve mě protistrana, která z toho dělá kdo neskáče není Čech. A taky tutlalové.

  528. Dano a Tucnaku – tak se Vam omlouvam

    nudim se doma v posteli tak diskutuji.
    Ale mate pravdu radeji toho necham pak tu nemuze napsat nikdo nic jineho.

  529. 513 souhlas, Foundry. Třebaže všeobecné volební právo je v politickém supermarketu podobné jako právo vybrat si jogurt, zubní pastu. Poptávka se řídí nabídkou a reklamou monopolních výrobců politiky, kteří uzavírají kartelové dohody, jak známe z koalic a z rozhodování zvolených zástupců. Co se týče nejen zde diskutovaných kjeklířských projevů, jsou bzučením mouchy. Úkolem kejklířů a komediantů je za drobty z panského stolu poskytovat kratochvilné pobavení. Jejich údělem je když už se stanou nudnými či dokonce obtížnými, být vypráskání z hradu, zámku, za městské hradby. V takovém případě panstvo káže odvázat psy a už to běží samospádem. Ostatně údělem šaška je být nakopáván, nikoli rozhodovat kdo jak má vládnout. Takový je přirozený řád světaběhu, třebaže jak pozorujeme, dočasně zvrácený. Přes všeliké nářky na drahotu a poměry se lidu dobře vede, neboť peněz a času na takové kratochvíle nelituje. Dobře mu tak.

  530. Co se týče „první dámy“, v konstituci se o ní nic nepíše, proto není nadána způsobilostí do něčeho takového mluvit. Stejně například jako manželka automechanika nemá co mluvit do toho jak má štelovat předstih a komentovat práci ostatních automechaniků.

    Co se týče aplikace nynějších zákonů na činy v minulosti, vzato stejným metrem Německo by muselo být navždy zrušeno.

  531. 608 Martine, tak jsme si předsevzal nejen tu, ale i jinde a všeobecně. Velmi šetřit „ostrými“ výrazy. Ne nezištně. Přiznávám, že když se ovládnu, oblažuje mě pocit nadřazenosti.

  532. Ve Vídni se ráno srazily dva příměstské vlaky- 20 zraněných- doufám, že Brouk se zrovna válel u bazénu a je zdráv a vesel.

  533. Schumi 620 – 608 to nic, to si jen jirka s martinem zakládají kádrové materiály … 🙂

  534. >> Schumacher 619
    Však také V.Havel chtěl kvůli Dášeňce nechat do Ústavy připsat aspoň jeden odstavec.

  535. 610: Noname: pepa nemůže být nikdy pedofil. Jedině pepofil 🙂
    616: pepo, neomlouvat, není důvod. Každému diskuse podle jeho potřeb. Do genetické diskuse jsem neměl čím přispět, pač o ní nic nevím …

  536. Druhá tříkrálová výzva …. je to v nich jak v koze!
    Ne, že bych o nich měla přehnané mínění, ale že budou blbnout až tak moc … ???

    …V pondělí začne rovněž fungovat telefonické centrum Schwarzenbergova týmu. Jeho příznivci z řad známých osobností z něj budou telefonovat voličům a přesvědčovat je, aby do čela státu volili předsedu TOP 09.
    http://www.novinky.cz/domaci/290835-schwarzenberg-sdruzuje-nerozdeluje-vyzvaly-zname-osobnosti.html

  537. Takže na titulku idnes přibyl článek
    Zeman odmítá vinu v kauze Mostecké uhelné. Fakta však mluví proti němu.
    😉

  538. No matzurce jsem do toho nemohl kecat protoze DNA rozumi jen tak ze jsem asi cast trokrat predal detem.
    Nez jsem to byl schopen precist tak tu laicke dotazy uz padly.

    Tucnaku ja se nestydim omluvit kdyz neco prezenu.

  539. PeSi, proc bych mel byt rozhorceny, samozrejme zekterykoli ourada ma jit do haje, kdyz se plete do politiky. co s tim Batorou furt mas… to jako ze Batora je fuj a tenhle je min fuj?

    Rputi, starou partu si sem zatahla ty, musis si holt vice pomatovat a nebo si delat poznamky.

    k ostatnimu nemam co bych dodal, snad jen ze se plte dost veci dohromady a bez ladu a skladu….. a ja pracuji a nejen to, sehnal jsem si odsolovaci zarizeni a objednal lahve lifesaver…. takova pecka, to az uvidite, kazdej ji bude chtit 😀

  540. 627 Noname, přečtěte si článek. Většinovým vlastníkem MU v době nástupu Zemana nebyl stát a obce. Hloupostí či zlým úmyslem se obce zbavily akcií MU a tím pádem většinu už držel někdo jiný.
    Mohl bych vyprávět jinou historii, ale to už je jiný les, jiná vesnice. A určitě by pravda a láska dostala na frak.

  541. nickname – podobný příběh jsou vodovody a kanalizace, taky na začátku vlastnily zdrcující většinu obce. Ale může za to Klaus.

  542. 629 Jirko, po použití skladujte v chladničce a nebo měňte včas čistící patrony 😉

  543. Noname jeden tucnak mi tu rekl at nekoukam kdo co okolo kandidata rekne ( neni to lehke )
    a koukam co rika ten kandidat.
    Mam ten cas tak to zkousim. Kaslu na 172 kejkliru jejichz polibek by byl smrtici a kaslu na privatizaci uhelne spolecnosti.
    Proste je posloucham a ctu.

    PS – vudci volbe kaslu i na nazory VK ( jenom mne tim strasne zklamal. Musim rict ze mu toto nikdy nezapomenu 😀 )

  544. od Pesa jsem dostal několik fotografií homo mobilis. V sobotu večer jsem to viděl na vlastní oči ve vinárně. Skutečně přišla skupina čtyř mladých lidí, usedli, vytáhli mobily a cvakali palci. Pak si nechali donést – kluci pivo, děvčata dvě deci – a cvakali dál. A jestli neumřeli, tak tak cvakají dodnes.

  545. Doporučuji ke čtení na psu pány Vlka a Kašpárka. I nevolením volíte 🙂
    Beneš nebo Gottwald? Kdo je kdo?

  546. no a ke chripce se mi rano do fabriky vloupala inspekce bezpecnosti.
    jsou hodni protoze prej mohu prijet zitra.
    kdyz to nestihnu tak pak mohu prijet , opet presny termin i na hodinu ( ne par moznosti ktera bude vyhovovat i me) , na konci mesice.

  547. jasně, chápu, přece zvednout oči a otevřít hubu je strašná námaha. Na klávesnici je to snazší.

  548. nickname nás odhalil. Ležíme v ústavu na jednom pokoji, ale vzkazujeme si přes blog.

  549. 641-a píše to za vás stejná zdravotní sestra.

  550. (599) „: Měla madam fotra u elektrikářů?“
    Do kterého kolene se tolerují jen plynaři?
    😛

  551. (635) že Vlk na sudeťáky „chytne na první šlápnutí“ byla pevná jistota.

  552. 647-ono ani matka těch détí obvykle nebývá bez viny, pepo, co si budem namlouvat… 😉

  553. Kdo vykecal nicknamovi – 643 – co znamená v našich končinách adresa Kroměříž?

  554. pepo, mají to ta děcka horší a méně zábavné než my. Když jsme se museli fyzicky vykrádat z ložnice, abychom druhé straně něco sdělili, tak to bylo dobrodružství. SMS je nuda.

    Když to vykrádání z ložnice nebylo doma, ale třeba na táboře a druhá strana nebyla příbuzná, tak to bylo ještě větší dobrodružství. A když nás chytili, tak to bylo vůbec největší dobrodružství. Co dneska zažiješ s IPhonem? Prd!

  555. Martine, poslala jsem mail a moc prosím o odpověď, ať mám aspoň jeden úkol z krku. díky

  556. Nickname, soudím, že v Kroměříži je , stejně jako v Bohnicích, plno…. 🙂

  557. martine, kdyz mas v ajfounu ten „videohovor“ taky je to dobrodruzo a docela zajimave 😀
    ja bych moderni technologie prilis nezatracoval

  558. 2 Šumavák – ad 653 – a což potom v Opavě…

  559. OT swetr report,
    hluboce cítím s východem, co klouže po náledí…. u nás od jedenácti opět sněží (na Schumiho stupnici pro to není výraz), takže mi druhdy desetiminutová cesta z práce trvala přes půl hodiny, a to se mi podařilo z kolony zmizet boční uličkou a vzít to domů opačným směrem. Za chvíli vyrážím zpět do města (kroužek…), tak se modlím, aby aspoň ta kolona už byla pryč. Zespoda to začíná přimrzat, bude veselo.

    Zpátečníku, ty výpočty jsou mnohem jednodušší, více raději večer, teď bych to nestihla naďobat.

  560. Mne Klaus nikdy nijak zvlášť nezklamal a kupodivu Zeman také ne. Naopak ho považuji stran jeho článku, vydaného v TT za komančů, za velice statečného pána. Protože jsme se s ním následně mírně podružili, tak i za velice vtipného pána. Onu VK+MZ oposmlouvu považuji za geniální a podle řevu PL úspěšnou. Jeho buranský styl je mi vcelku sympatický, neb i já jsem byl pro drtivou většinu mých pražských inteligentních spolužáků totéž.

    Pana KS jsem již z mnou shora uvedených důvodů (měl za někoho odpovědnosta na celé čáře zklamal) neměl rád od první chvíle, kdy se v ČSSR objevil a kdy se motal u riti VH. Kandidatura za zelené hrůzy, schvalování a komentáře k LS, humanitárnímu bombardování, uznání muslimského Kosova a další milé skutky vč. hlasu pro zelenou energii pro mne znamenají jediné: Degenmere odpal, ať již se to někomu líbí nebo ne. Je to mé soukromé rozhodnutí, které nehodlám nikomu vnucovat. Stejně tak je ovšem zbytečné přesvědčovat mě. Howg.

  561. 650 ja si spletl tlacitko v mobilu pri odpovedi 😀

    651 jj nejsou trenovani a pk se vsechno hned vi.
    nebo je jim to ted jedno ?

  562. Matzurko, držte se – na silnici, pochopitelně.

    Tady zatím žádné kalamitní stavy, ačkoliv minulý týden anapadly dokonce cca třikrát tři centimetry sněhu ( u muzea jsem nebyla, tak nevím)

    Ale je pošnourno , šedivo, hmlisto ačkoliv Libuš hlásí -3, mokré silnice, klouzací chodníky a zrovna sněží.

  563. andy, minulo se to o minutu a už jsem byl mimo. Teď už jsem četl otázku i napsal odpověď.

  564. 661 tak – neciiiist !!! 🙂
    ja odborare i prepl v TV 😀
    ale asi musim koncit s prezidentskou volbou

    prisla mi domu z uherskeho hradiste hilzna 😀

  565. 650 Martine, když občas vykládám moudra o Bitýzu, Vikmanově, Beřkovicích a jiných ústavech, nemám to jen vygooglené 😉
    Hurá do práce na facebook. Když máte skupinu s podporou 80+ pro KS, nemůžete jim nerozbíjet hračky. 🙂

  566. 662: a ztroskotanci.

    Co se týče reklamy kandidátů, uvažuji, že bych se měl přihlásit až prezident Miloš Zeman bude s předsedou vlády (chtělo se mi napsat Václavem Klausem, ale přichází mi to až příliš odvážné) probírat kdo bude ministrem čeho. Umím řídit tank. Jak jsem vyslechl Zemanův k voličům, to rozhodně není málo!

  567. Paní Maydo, pane Schumachere, dovolil jsem si:
    Do hry vstupuje ruské třídění lidí: není náš, je cizí … Kdo si nepřeje jeho volbu, staví se do jednotné fronty, která spojuje Zemana s Klausem,…

    Když jsem byl ještě malý kluk, říkal jsem: podle sebe soudím tebe.

  568. maYdo, všechno jedno, emoce vládnou, emoce bublaj, emoce cákaj jak protržený potrubí!
    Dobře nám tak, neměli jsme si koledovat o přímou volbu – dalo se čekat…
    Ale už je to dost únavné.

  569. … Rozplynuly se národy, které se neosvědčily či ztratily vůli k vlastnímu svérázu…
    Kašubové nebo Lausitzer by mohli vyprávět. Karlíčku, Karle, co blázníš.

  570. Jo ztroskotanci, schumachere. já věděla že ti vyděděnci není úplně ono.
    To ten neměc, co mi schovává brejle a mobil a z tiskárny krade papíry, který jsem přece určitě vytiskla, mně tak zblbnul.

  571. Nickname,
    já to nějak politicky neřeším…
    mně jen zaujal ten barvitý slovník z jiné epochy.

    Ale jinak, když si to vyhodnotíte a oklepete ty sylistické ornamenty, tak v tom sdělení není nic než “ kdo nevolí knížete , je bůhvíjaká existence, nepřítel a bacha na něj“.

    Takhle přeloženo to sdělení už nemá tu humornou rozutomilost jako „temné katolické pseudokonzervativce“ a jednotná fronta zemana s klausem“

    No a co čápi a vrány? Někde se zdrželi?

    Ostzatněš to temní katoličtí pseudokonzervativci – ať se dívám zprava nebo zleva, ať to politický hnojiště vidlema přebírám, to označení pasiuje na partaj, která knížete nominovala.

    Tak za koho vlastně ten Stergeiwald kope?

  572. \Co se divíte, rputi, zaregistrovala jsem některé jedince, kteří vedli řeči, jak tuto vládu naházet do vltavy a na Kalouska nabrousit vidle, neb je to pekelník největší – a ejhle knížeti, za kterým ten Kalous stojí a který je místopředsedou té vlády, co ji chtěli naházet do Vltavy, se najednou klaní po pás a vůbec jim to není divný a ještě se štětí, když se Vy klanět nechcete.

    Nějak nevím, proč ten povyk, nakonec prezident u nás nemá moc pravomocí.

  573. Tak mě napadá…ten klid, to ticho….
    Ten ústavní soud s těmi stížnostmi čeká na to, kdo vyhraje, ne?
    Když KS, tak se jimi zabývat nebude, Když MZ tak budou opodstatněné a volba neplatná?

  574. Omluva Stránského mně docela potěšila. Alespoň někdo umí vychladnout a nechová se furt jak přetopenej kotel.

  575. Šumaváku: mohu se mýlit, ale mám dojem, že ÚS konstatoval, že stížnost je víceméně blbost a volby mohou normálně pokračovat. Pokud vynese nějaký doplňující verdikt (třeba to, že chtít 50.000 podpisů je fuj), bude se to týkat až voleb dalších.

  576. Adam B. Bartoš je podobně blbej jako většina journalistů – tedy neskonale 🙂 Trochu si popletl hrady 🙂

  577. ted jsem cetl v clanku o plynu v israeli krasnej vtip 🙂

    zraelský premiér Netanyahu dával k dobrému anekdotu, že Mojžíš 40 let vodil svůj lid pouští, aby našel jediné místo, kde zde není žádná ropa.

  578. A hele
    Kandidát Fišer dává přednost Zemanovi

  579. No ten je starej jako bible sama…
    A s plynem ať si nezahrávají, je to terorista. viz: http://www.novinky.cz/krimi/290738-vybuch-v-bioplynove-stanici-vazne-popalil-dva-muze.html
    Na druhé straně můžeme hrdě říci , že v rozvoji obnovitelných energií mílovými kroky doháníme tak technicky a technologicky vyspělé státy, jako je Německo.
    Ovšem nikoliv v novinářské práci! Tam pravidelně ještě informují, jak tuny rozstříknuté močůvky smrdí nejen ve vesnici, ale i v okolí… 🙂

  580. 687
    Šumaváku, to je vidět, že pasáček je rodinný typ a nechodí do putyky jako my, co ten ftip z hospod známe 🙂

  581. divano zrovna jsem chtel psat sumavakovi ze jsem mladsi jak on tak ten vtip nemuzu znat od zacatku.

    ted kdyz jste se pridala tak to nechejme na tom ze nechodim do hospody coz temer opravdu nechodim

  582. Fujtajbl to je hnus. Teda na silnicích tady v okolí. Aby nedošlo k omylu. A je pravda, že všichni účastníci silničního provozu, až na jednoho poděsa ve služební nákladní dodávce a téměř všechny chodce, se chovali přeopatrně. Chodcům jakoby nedocházelo, že když oni kloužou po dvou, ti v autech kloužou úplně stejně po čtyřech.
    Teď se déšť změnil ve sníh.
    A mě víc než presidentská kampaň zajímá, jestli mladí zítra ráno dovezou Sebíka na hlídání nebo si ho nechají doma.

  583. dano uz jste jim volala at zustanou doma?
    i kdyz doufam ze zitra kolem desate by to uz priroda spolu se silnicari zvladnou

  584. tož, Pavle, zas nemůžeš poo těch kadeřnících chtít, aby hledali vlasy na některých pánských hlavách zadarmo. 😀

  585. Hmm, tak petici na podporu Schwarzenberga podepsalo 270 vědců. :-O

    http://aktualne.centrum.cz/prezidentske-volby/clanek.phtml?id=769157

    To už je skoro jako když podepisoval „Kolektiv dojiček z Hoštic“, „99 Pragováků“ nebo „Brigáda socialistické práce státního podniku ČKD“.

    Jsem zvědav, jestli po volbách nastane v akademické obci horečné pátrání po tom, kdo nepodepsal. Nebo naopak, kdo podepsal.

    Některým lidem v tomhle státě jebe fest. 🙁

  586. Já mám strach , jestli s něčím takovým nepřijdou i zubaři. To by mě kleplo 🙂
    A něco pro odlehčení
    4z 5 koček volí Kitekat . Jen jedna Kchàrla 😉

  587. Lidi, já jsem prostá venkovanka z dálného východu, momentálně zamrzlého, ale může mi někdo zdejší, nebo ještě lépe některý z petentů petice zmíněné v 695 vysvětlit, proč v době přímé volby presidenta se sepisují petice na podporu jednoho z kandidátů? Není snad vhození volebního lístku do volební urny základním a nezvratným vyjádřením podpory toho kterého kandidáta? A to fakt sepsali a podepisují vědci, lékaři a vysokoškolští pedagogové? Badatelé???? Jak říkám, jsem jen venkovanka.

  588. No pratele budme k sobe uprimni… .ty volby nam seslalo samo nebe, a to mame jeste dobrych deset dni pred sebou. Vite kolik lidi se tady zaseberealizuje ?
    Vzpominate na „Cunka“ ? S tim jsme vydrzeli u Neffa poctive tri mesice, i kdyz pravda tam to puschoval jeste Cumil . . . 😉

  589. tak ono to je tak nejak ocekavane .
    KS podporuji jednotlivci peticemi
    MZ zase spolky usty jejich zastupcu.

    ja bych to naopak ani necekal. Dokonce mi je tem styl u MZ sympatictejsi jenom kdyby to byly jine spolky .
    no abych to dorovnal – u KS vetsinou jini lide 😀

  590. No jediné co mně u těch vědců napadá je to, že by se to snad mohlo hodit v budoucnu jako takové hezké argumentační kladivo do vědeckých disputací. Například:

    „Vzhledem k tomu, že kolega Doc. Myšusta již v minulosti několikrát přesvědčivě dokázal, naposledy svým podpisem/nepodpisem (nehodící se škrtněte) petice na podporu Karla Schwarzenberga, že nemá nejen ponětí o realitě, ale ani dostatečné morálně volní vlastnosti, nelze jeho teorii aplikace nesymetrických stavových grup na problém kvantové chromodynamiky brát vážně. Proto je jeho publikaci nutno odmítnout v celé šíři, aniž by bylo nutno zabývat se podružnými detaily…“

    🙂

  591. Dano, oni někteří vědci, jsou v čemkoliv, co se jejich oboru netýká, úplně mimo a jak malý děti. To, že někdo chápe vyšší matematiku nebo jaderné procesy ještě není zárukou toho, že taky chápe tenprostý fakt, že volby nesjou, nebo aspoň neměly by býut o sepisování petic.

    Nebo si někdo z nich myslí, že když teď projeví iniciativu, tak na to bude moct později poukázat v žádosti na grant. 😀

    Na druhou stranu, o těch, co dělají svoji práci a nehrají si na volební agitátory, prostě není slyšet. Ale jsou a věřím, že víc, než těch, co sepisují debilní petice.

  592. Vy jste jak malí! Copak byste chtěli, aby chudáci studenti a učitelé New York university of Prag dopadli jako Dejdar, když Pehe podpořilo KS???
    Máte rozum?

  593. Jinak tedy mně v tom článku nejvíc pobavilo:

    Podle Petra Svobody, šéfa jedné z výzkumných skupin Ústavu molekulární genetiky AV ČR a zároveň jednoho z petentů, vyjadřuje tato petice většinový názor, který mezi akademiky jasně převládá.“

    „Myslím, že ve druhém kole má Karel Schwarzenberg na univerzitách a v Akademii věd masivní podporu. Oproti tomu podpora Miloše Zemana je ojedinělá a mezi mými známými není nikdo, kdo by se k ní otevřeně hlásil. Z pár diskusí, které jsem vedl s kolegy, vyplývá, že je Zeman nepřijatelný mimo jiné kvůli oposmlouvě, svému vulgárnímu chování a taky proto, že po Václavu Klausovi představuje kontinuitu nedávné minulosti,“

    si tak představuju, jak si šéf jedné z výzkumných skupin ve státem placeném ústavu pozve postupně své kolegy na kobereček, veřejně deklaruje, že on tedy volí Schwarzenberga a ptá se kolegů/podřízených, kterého kandidáta podporují. A on se jak na potvoru nikdo k Zemanovi nehlásí. Tedy rozhodně ne otevřeně. 🙂

  594. Nojo a prý Zeman s Klausem chtějí za každou cenu udržet moc.
    A to KS rozhodně ne, tomu žřejmě stačí udržet moč. On vlastně ani presidentem být nechce, ale když mu to tak nutí… tak odmítnout by bylo nešlšné 🙁

  595. No v každém případě je potřeba vědu podpořit, i když jsou někteří výzkumníci mimo laboratoř tak trochu … jak to říct … Naivní ? 😉

  596. Zvlášť po tom, jak dopadl Dejdar, že jo, Pavle? 🙂

  597. Ale tak zase ten Svoboda podporu vědy nejspíš nechce, když říká, že kvůli Schwarzenbergovi je ochoten vydejchat i toho Kalouska…

  598. Možná dostane pan Svoboda grant na naklonování Schwarzenberka … Když je tak cool 😉

  599. Ale vážně. Těm vědcům, akademikům a pracovníkům třeba z PřFUK opravdu nerozumím.
    Zejména ne poté, co mi PeS poměrně podrobně cestou ze Šumavy vysvětloval, co za svinstvo je ve skutečnosti ten nový návrh zákona o VŠ a jak se Kalousek and comp. třesou na universitní a akademický majetek.
    A když si představím, že proti téhle vládě akademičtí a studentští pracovníci dokonce demonstrovali a stran toho návrhu zákona o VŠ psali též nějaké petice.

  600. Každopádně se začínám cítit méněcenně, protože to skoro vypadá, že kdo nesepsal a/nebo nepodepsal nějakou petici, jako by nebyl.

    Nechce někdo sesmolit též nějaký traktát ve smyslu „Nevolte ty dva blbce“, že bych to podškrábnul ? Mediálně presentovat to můžeme třeba jako „Kolektiv ajťáků z Podbrdska“ nebo tak něco. 🙂

  601. Možná akademici doufají v reinkarnaci stařičkého mocnáře. Nějaký takový projev atavismu…

  602. Představte si tu krásu – hradní hudba hraje Radetzky Marsch, hradní stráž pochoduje, mocnář vlídně kyne a pak se jde projít na Karlův most. Není to nádherná představa? A šlapky z Václaváku mu nesou posolenej chleba…

  603. Pavle, to jsem už psala někde výš. Jako by ani schwarzenberk nebyl místopředsedou vlády, kterou někteří z těch, co se dnes klaní a sepisujou petice na jeho podporu, chtěli naházet do Vltavy.

    Ale jde asi o sortu lidí, kteří v podstatě nepotřebují prezidenta, ale totem, kolem kterého by mohli skákat, vřeštět a klanět se mu.
    S amuletem na krkju, pardon, s plackou na klopě.

    Abych byla nestranná, tak i ten Klaus byl pro některé totemem. Ale nebyl tak přitažlivej,a si neměl tu magickou sílu, tak kolem něj jich neskákalo a nevřeštělo tolik. A některé štval a ti skákali, vřeštěli a místo klanění plivali.

    Konec konců, to je úděl prezidentů.

  604. 716- při tom sortování, nezdá se vám, že ty volby prožíváte ňák moc- skoro jako kdybyste byla ve štábu?

    Klid, už to tento týden skončí a nepopiratelný fakt, že kdyby Klaus podpořil KS, nyní byste napalovali Zemana a jeho voliče budete moci zapomenout.

  605. Sorry Andy, ale pro mně osobně je Klaus dost irelevantní. Já jsem tady ještě minulý týden po 1. kole psal, že to hodím Schwarzenbergovi. A kdyby to nepodělal těma BD, tak bych mu to možná i hodil.
    Takhle to holt nehodím nikomu, což mi ovšem nebrání se smát (či dokonce posmívat) poněkud hysterickým příznivcům jedné či druhé strany a celkově tomu mediálnímu blbnutí.

  606. Jako názor ke Schwarzenbergovi tu pastnu majl od známého –
    Jo, budu volit Schwarzenberga (jako menší zlo), kdyby tam byl Fischer, tak ze stejného důvodu Zemana. Schwarzenberga do jisté míry chci i proto, že moje dcera (diplomatka) říká, že horšího ministra zahraničí jsme neměli. Totálně na to s…, zajímá ho jen šlechta a získání vlastního majetku, např.(byla do prosince gen. konzulkou v xxx), když tam bylo setkání všech ministrů zahraničí z EU nebo odkud, tak tam poslal nějakého čičmundu a odjel na sraz šlechty. Takže když bude presidentem, nebude aspoň ministrem zahraničí…ovšem jeho ovečky tam zůstanou…(. No, ale může tam přijít stejný pako. Např., aby „ušetřil“, zrušil gen. konzulát v Bombayi (!, velice zásadní). Dcera tam byla asi 2 roky předtím generální konzulkou a řekla: jo, ušetřil ministerstvu ročně asi 3 miliony, ale my přinášeli do státní pokladny 5 mld. Zrušil velvyslanectví ve velice důležité Keni, což se nedá jen tak obnovit atd. Přitom tyto státy nás v OSN podporovaly a když jim teď takto dáme najevo nezájem a pohrdání, tak už těžko.

  607. 719- je to vaše výsostné právo, Pavle, to je výhoda současných voleb.
    Jen mne mrzí, že na mou 340 nikdo nezareagoval…pak bych se třeba začala řečí okolo BD bát:)

  608. 717- tedy fakt uz nepijte. . .to myslite vazne, ze je tady nekdo, kdo se rozhoduje podle Klause? ?
    A ze to je „nepopiratelny fakt #???

    Tak to je horsi, nez jsem si dosud myslel. . .

    Mate samozrejme pravdu, ze. . .hlavne se nerozcilujte, klid

  609. Andy, to 340 je konstatování. Na to nelze v podstatě nijak reagovat.
    Leda snad (tedy v souvislosti s presidentskou volbou) začít mudrovat o tom, zda je větší nebezpečí KS s jeho vazbou na Německo/Rakousko či MZ s jeho vazbou na Rusko.

    Eventuálně bych mohl oprášit svůj postarší názor v tom smyslu, že je nutno zbrojit a to včetně zbraní chemických a biologických (na jaderné nemáme). Jenže tento názor byl už kdysi dávno kolektivně zavržen ještě na Psu a od té doby stejně jaksi státu došla škvára, takže je to nereálné.

  610. pasacku – ad 723

    No z mého hlediska můj hlas jednoznačně prokoučoval tím, že když na BD přišla řeč, tak jednoznačně neřekl něco v tom smyslu, že odsun Němců po 2. sv. válce je dávno uzavřená a neměnná kapitola o které nelze vést žádné diskuse ani spory. To by mi tak nějak stačilo a dokonce bych po něm ani nechtěl to klasické polské vyjádření ve smyslu „Revidovat výsledky války lze jen další válkou“.

  611. pavle ale jo je to nazor a je na nej pravo.
    bral bych to ze si to u tebe podelal ale ne ze to podelal.
    I kdyz vlastne podelal protoze nechal spustit tu hruzu co tu leze ( vedle petic) o hakovych krizich v loznicich kandidata.

  612. dobre to tu napsal kdesi aero karel.
    s primou demokracii bych zacal pomalu od spodu.

    treba bychom se to naucili na dedinach pri volbe starosty.

  613. jen bych připomněl, že na Slovensku mají přímou volbu starostů už od začátku. Výsledkem je taky starosta, který skoro neumí číst – viz Youtube.

  614. 724- však jsem kdysi váš postarší názor ohledně vyzbrojování vehementně podporovala, pokud si vzpomínám.

    Co se Ruska a Německa/Rakouska týče, pořád dávám přednost těm možná zlejším, ale rozhodně civilizovanějším germánům.

  615. No jo, Andy, koukám že, máte zas jasno, co by, kdyby….

    Jedinej nepopiratelnej fakt,co by kdyby je, že kdyby byly ryby v prdeli, nemusely by bejt rybníky. Všechno ostatní je jen spekulace.

    A možná i ty rybníky by musely bejt, aby měla kde plavat a kejhat vodní drůbež.

    Jinak račte prominout, nepsala jsme nic o knížeti, pouze o blbnutí některých jeho uctívačů.
    Mně je jedno, kdo koho volí, ale eklují se mi lidi, kteří sepisují petice a kladou na ostatní požadacvky, jak mají volit

    Jo a příště buďte opatrnější s těmi nepopiratelnými fakty. Nejsem sice honěná ve filosofii, ale spekulaci „co by, kdyby…“ sotva můžete vydávat za nepopiratelný fakt.

  616. pasacku – ad 727

    To jsem popsal v příspěvku 473 a nemám, co bych k tomu dál dodal.

    Obecně vzato, možná jsem naivní až dětinský nebo se do moderní doby prostě nehodím. Nicméně od českého presidenta očekávám, že bude hájit české zájmy a to bez ohledu na to, jestli s nimi vnitřně souhlasí nebo ne.
    Pokud by chtěl hájit zájmy německé, rakouské či ruské, velmi rád mu/jim popřeju hodně štěstí v presidentských volbách v Německu, Rakousku či Rusku.

    Tímto jsem doufám svůj postoj k presidentské volbě před zdejší kádrovou komisí dostatečně objasnil a nadále se budu věnovat pouze komickým momentům z jednoho či druhého tábora, protože hlubokomyslné úvahy o tom jestli KS nebo MZ jsou pro mně nadále řádově méně důležité než dumání o tom, jakou lahev vína si otevřu k večeři. Howgh.

  617. Pepo, jestli je to jeho názor, tak je trapně podobný oficiálnímu názoru SDL, že Beneš byl válečný zločinec a že jeho dekrety jsou neplatné.
    A budu-li nahlížet tehdejší události prizmatem dnešních zákonů a „lidských práv“ jako KS, tak nahlédnu-li do toho hranolu z jiné strany, mohu dojít k úplně jinému závěru:
    -odsun Němců byl naprosto mimořádný státnický čin, který zachránil miliony životů lidem, kteří tu mohli být nejen internováni(a že by asi bylo kde) ale i odsouzeni k trestu smrti.
    – odsunutí byly odškodněni vládou BRD( někteří prý i dvakrát), což se v ČSR neodsunutým Němcům , natož v r. 1938 odsunutým Čechům nepoštěstilo.
    – Odsunem do Německa je ochránil před dalším znárodněním majetku v r. 1948.
    – Odsunem do Německa jim umožnil žít život ve svobodné zemi a nezažít 40 let socialismu( i když s EU si ho ještě zažijí) a nezažít ruskou okupaci.
    – Odsunem sudeťáků do Německa zajistil klid a mír v Evropě až do dnešních dnů a vytvoření druhé Jugoslávie ve stř.Evropě…
    Ukažte mi jiného takového politika, o kterém lze říci, že zachránil životy třem (dnes už sedmi)milionům lidí!

    BENEŠ FOR Nobel Peace Prize !!!

    Nešlo by to vykládat také takhle?
    A co teprve, kdyby se podle dnešních zákonů a lidských práv posuzovala poprava 27 českých pánů…

    No, a pokud jsi si přečetl tu řeč k českým novinářům, můžeš si číst dál třeba zde:
    http://www.ceskenarodnilisty.cz/clanky/prof-judr-vaclav-pavlicek-drsc-o-legalite-a-legitimite-transferu-nemeckeho-obyvatelstva-z-ceskoslovenska.html

  618. Pavle, ještě že láhev. Von ten krabičák je děsný svinstvo 🙂

  619. pánové, pořád se mele o Benešovi, jak ten odsun, ale já se nějak nemůžu zbavit dojmu, že odsun se dohodl na Jaltské konferenci a že tam byl Beneš vedle Churchila, Stalina a Roosevelta moc malej pán na to, aby sám a osobně rozhodl o odsunu, an iž by se nekoho tázal.

  620. A tady máš jedno kratší shrnutí, které se ovšem SDL nelíbí a neustále zkouší jak ty smlouvy obejít.

    Odsun sudetských Němců z pohledu mezinárodního práva
    Základ k odsunu tzv. sudetských Němců položil Neville Chamberlain. Sužoval se myšlenkou,že Anglie se třeba neubrání Němcům v bitvě o Británii v roce 1940, protože sám zdržel zbrojení v rámci „míru za našeho života“. Anglii chyběly zbraně všeho druhu jeho vinou. Jednal na základě léčky, kterou mu nastražili Němci pomocí exponentů německé menšiny v Československu, Henleina a druhů, kteří jednali dle směrnic německé vlády, že chtějí mír a mírové řešení.
    Anglie se zasloužila po první světové válce o odsun řecké menšiny z Turecka do Řecka na
    základě Lausanské smlouvy mezi Řeckem a Tureckem z roku 1923 (Treaty on Exchange of
    Greek and Turkish populations, January 30. 1923, 32 LNTS 75). Chamberlain navrhl, aby po válce byly odsunuty do Německa německé menšiny z Československa a Polska, aby se vyřešil tento problém jednou provždy, tak jak se stalo mezi Řeckem a Tureckem. Anglická konzervativní strana přijala tuto myšlenku a provedla ji. Britská vláda přesvědčila USA a SSSR o výhodách tohoto řešení a výsledkem byl protokol Postupimské konference z 2. srpna 1945. Odsun byl proveden na jeho základě.
    Prezident Beneš by nebyl vůbec nic docílil, kdyby zde nebyla vůle britské vlády z vlastní iniciativy odsun přednést spojencům a dosáhnout jejich souhlas.
    Jinými slovy, bez britské vlády by se byl prezident Beneš namáhal marně. Je samozřejmé,
    že Československo nemohlo Němce vyhostit, poněvadž je museli přijmout spojenci, kteří
    vládli v Německu a Rakousku. Odsun připravila Mezispojenecká komise v Německu. Němci
    byli odsunuti do americké a ruské zóny podle přesného plánu v roce 1946. Československo
    odsun nezpůsobilo a nemá za něj odpovědnost. Odsun se konal pod dohledem Mezispojenecké
    komise a Československu se dostalo uznání za jeho humánní provedení. Jakékoliv nároky
    ohledně odsunu by německá vláda měla předložit USA, Velké Británii a Rusku. Není ovšem
    tak naivní, a tak periodicky vznáší nároky na Českou republiku, ale pouze prohlášeními politiků, nikoli úřední cestou. Předpokládá zřejmě, že Češi si nechají cokoliv namluvit a budou jednat proti vlastním zájmům.
    Německo a Němci nemají žádné nároky z vysídlení, poněvadž Německo je vázáno smlouvou
    mezi ním a spojenci z 26. května 1952, doplněnou v Paříži 23. října 1954 (Convention on
    the Settlement of Matters Arising out of the War and Occupation, signed at Bonn on May 26,1952, as amended by Schedule IV to the Protocol; on the Termination of the Occupation Regime in the Federal Republic of Germany, signed in Paris on 23. October 1954) 332 UNTS 219.
    Podle kapitoly 6 článku 3 Německo neuplatní námitky proti spojeneckým státům ani jednotlivcům vzhledem k použití německého majetku, který převzali spojenci či jednotlivci jako reparace nebo jako následek války. Podle kapitoly 8 článku 1 němečtí příslušníci neuplatní žádné nároky proti spojencům a jejich občanům a takové nároky nebudou projednávány německými soudy. Podle článku 3 téže kapitoly Německo nebo jeho příslušníci neuplatní žádné nároky proti spojencům a jejich příslušníkům, které vznikly z jejich činů nebo opomenutí mezi 5. červnem 1945 a nabytím platnosti této smlouvy 5. května 1955.
    Jak patrno z uvedené smlouvy, veškerý majetek německé vlády a jednotlivých Němců na
    území Československa přešel do vlastnictví Československa a jeho občanů jako splátka na
    reparace za škody způsobené Němci. Československé nároky za škody způsobené Němci vysoko přesahují zmíněný německý majetek. Německo nikdy nezaplatilo Československu jakoukoliv náhradu a je dlužníkem České republiky, nikoli naopak.

    Prof. Dr. GEORGE GLOS
    J. S. D. (Yale)
    (Autor působí jako expert mezinárodního práva u federální vlády USA ve Washingtonu)

  621. jejda, přehlídla jsem odkaz.
    Takže oprava – nebyla to Jalta, ale postupim a ne Roosevelt, ale Truman.

    Ale každopádne odsun byl zřejmě aktem mezinárodního práva a Benešovy dekrety byly zřejmě nedůležitým kolečkem v celém soukolí, takže proč takový povyk kolem dekretů,?

  622. PS.
    A protože recipročně nedošlo k odsunu turecké menšiny z Kypru, vypadá to dnes na Kypru jak to vypadá….

  623. Sumavaku vis snazim se vetsinou aby mne neovlivnovalo prvotne kdo skym a hlavne jak podano prez transformaci “ chteni“
    proste mne vetsinou vic zajima ten trapnej pokus co opravdu.
    Proto se mi nelibi chovani justice i kdyz jde o ratha a schytam to protoze jsou spatne silnice.
    proto klidne reknu ze mne nase pater sere vic jak unijni a jsem eurohujer
    proto klidne reknu ze mne cela rodina klause zklamala
    proto klidne nereknu ze mne petice kejkliru zklamali – protoze je neuznavam s petici nebo bez petice.
    proto klidne budu bojovat za to ze KS to tak nerekl – jak jsem psal rano odkaz poslechl jsem si to cele a na vlastni usi.

    proto tu nebudu jako odpoved na otazku kolem prezidenta davat odkazy na proslovy gottwalda , stalina nebo lenina.

    o nazorech sudetaku minimalne z rakouska jsem si toho poslechl dost od kolegy – ty vis i jak se jmenuje – myslim ze to co ctu , bohuzel i tady , je horsi.

    o diskusi tady jsem si myslel ze je diskuse a ne kadrovani .

    vcera jsem neco slibil dane a tucnakovi a nedodrzel to – slib se ma dodrzet a kdo tak neci ma dostat po drzce.
    tak jo jen mi je divne.

  624. PS – a presne takto to chteli lidi kolem MZ vyvolat .
    jedine o cem se bude mluvit tak o debilitach jak nas zaberou nacisti.

  625. Díky za ten souhrn, Šumaváku.

    Jsem to tak nějak tušila, V případě Benešových dekretů
    jde hlavně o toml, že na rozdíl od jiných my nihoho nepošleme někam, místo toho si začnou politici a komentátoři sypat popel na hlavu se slovy „jak jsme mohli dopusit“ a to všetně těch, jejichž babička se v tu dobu mohla tak učit sedět na hrnci.

  626. Pepo – nerozumím. Já někoho kádruju? Nebo tučňák?
    Už aby ty volby byly za námi.
    Já dnes navštívila své minulé pracoviště a nebyla to návštěva z veselejších. Většina lidí, co jsem tam potkala, je mírně řečeno rozladěna z děje po 1.1.2013. Ano, pomalu se daří rozvrátit státní správu po kousíčkách, po troškách. Jen nevím, jestli z toho budou v konečném výsledku mít státněúředníkobijci radost. Obávám se, že nikoli.

  627. dano ne ja vam a tucnakovi slibil ze uz nebudu psat .

    kadrovan se tu citil pavel a mne to prekvapilo.

    a nesmyslne vyklady nezkoci jednema volbama

  628. Schwarzenberg: „Stranickou příslušnost sundám jako kabát,“ odpověděl na výhrady.
    A to mu docela věřím. Od rakouských lidovců, k českým zeleným a od nich do TOP09 mu opravdu nědělalo žádný problém. 😀 😀

  629. Pepo – já chtěla, abyste nepsal? Fakt? Vy mě překvapujete čím dál víc.
    Je pozdní noc – dobrou!

  630. „… debilitach jak nas zaberou nacisti.“

    Mno, debilita, jak se to vezme. Když budu hodně velký realista a na férovku úplně drsnej, tak bych zmínil pár drobností.

    1. V současné době se Francouzi fackují v jakési africké prdeli (tuším Mali) ačkoli tam mají pramálo co dělat.
    2. Humanitární bombardování si pamatujeme všichni. Mimochodem, já s tím bombardováním souhlasil a nadále souhlasím. Se Srby to jinak nešlo. Ale zmiňuju to pro pořádek.
    3. ČR nemá společné hranice s Ruskem. Pravda, někteří si toho doposud nestihli všimnout, ale mezi ČR a Ruskem leží Slovensko, Ukrajina, částečně Polsko a Maďarsko.
    4. Na druhou stranu ČR bezpochyby MÁ společné hranice s Německem a Rakouskem (které mimochodem včera odmítlo profesionální armádu a nadále trvá na branné povinnosti).

    Takže sorry, ale z čistě mocenského hlediska mně risiko ruské vojenské intervence nechává částečně chladným (i když ne úplně, protože strategicky se Německo posledních cca. 20 let opět paktuje s Ruskem, viz ropovody). Na druhou stranu, z Rakouska a Německa je to do Prahy co by minou dohodil (kdo jsi bez miny, hoď kamenem) a světová média by si toho ani nemusela všimnout, když tady nemáme ani ten blbej americkej radar.

  631. Jo pravda, zapomněl jsem na možnost, že by tady Rusáci mohli uskutečnit výsadkovou operaci. Ale tolik vodky snad ani v Rusku nefasujou, aby vyskákali doprostřed EU a měli dojem, že jim to projde v mezinárodním měřítku.
    A to nemluvím o tom, že by si museli s Ukrajinou a Slovenskem domluvit přelet, což by se nejspíš rozkecalo.

  632. Šumaváku: no tak to jsme v prdeli. Viz poslední odstavec v 747.

  633. I když mně částečně uklidňuje, že přesun části ruských leteckých sil na provisorně vybudované základny v Německu by nejspíš též neunikl pozornosti.

    🙂 Přesně tenhle scénář moc hezky pojednává kniha „Obchodní válka“ od Larry Bonda. Včetně toho, že průser začne zhroucením sociálního státu ve Francii, Španělsku a Německu. Kdo nečetl, vřele doporučuju pro dlouhé zimní večery.

  634. I když tedy musím uznat, že autor si jak Čechy, tak nejspíš Poláky blbě idealisuje, protože v knize jaksi potají jak české, tak polské vlády ulévají ročně cca. 10% HDP do zbrojení a následkem toho překvapí zcela netušenou výzbrojí spojené německo-ruské jednotky zhruba na linii Labe a zastaví jejich postup natolik, že US Army stihne najít prdel vlastníma rukama a zakročit.
    Něco takového lze bohužel v praxi jen obtížně očekávát, když každý pyskuje jestli potřebujeme obrněné transportéry, stíhačky a jestli nejsou ty nové pušky moc drahé…

  635. 747- no tak pokud má někdo obavy, že nás sežere EU, jistě nemá na mysli že se tak stane vojenskou operací.
    No a já mám obavy, aby nás stylem obchod-vstřícnost-vydírání nesežrali spíš ti rusáci.

    Tanky jsem tentokrát fakt neměla na mysli.

  636. Andy: tak na obchod musí být dvě strany, že ano. Jedna která něco kupuje a druhá, která něco prodává. Transakce je navíc učiněna jaksi dobrovolně.

    Pokud vyjdeme z vřeštění levice o vytunelovaném státu, který víceméně nic nevlastní, tak by se eventuálně jednalo o čistě soukromé transakce soukromých subjektů, po kterých je každému kulové.

    Pokud by toho stát vlastnil naopak až tak moc, že by při prodeji Rusákům hrozilo „sežrání“, tak se nejspíš ten socík za posledních 23 let moc nezměnil a většina majetku je tak nějak ve vlastnictví všeholidu. Pak ovšem nechápu, proč všeholid tak ječí, že nám tu nic nepatří… 🙂

  637. 2 Pavel Kořenský – ad 695 – tak jsem si ty signatáře prošel… Mnohé znám a nic jiného bych od nich nečekal… Takže asi tak…

  638. Připravte si žaludky na zítra. Je připraven veřejný dopis učitelů PORGU, žádajících hlavu Klause jr., za urážku starostenské nohy, eh, čo hovorím, „řečové vady“ svatého karla, Zeman lhal, že byl ve svazcích STB veden jako nepřátelská osoba, byl prý pouze „sledovaná“ osoba, dále výsměch Fischerovi, ze kterého konečně vypadl jakýsi názor, ale samozřejmě zas „nesprávný“. Všichni „chápou“ chudáka Stránského, že toho Dejdara prostě v rozčilení vyhodit musel, nejvíc Horáček s Pilipem a Wagnerovou.
    A na závěr vyjádření „renomovaného“ novináře: Petr Honzejk statistika nuda je, honza fischer …da je….

  639. Dobré ránko!

    Zatímco obsazení Kotlinky Landsmanchaftem by bylo přece jen složitější a nějakou chvíli trvalo, tak Kalouska s Bakalou máme přímo za zadkem a Fajmonovy obavy jsou, řekla bych, zcela na místě.

    …Europoslanec je znepokojen i Schwarzenbergovými vazbami na Miroslava Kalouska a uhlobarona Zdeňka Bakalu. „Schwarzenberg na Hradě rovná se ovládnutí České národní banky Kalouskem a Bakalou. To je přímé ohrožení české suverenity a ekonomické stability a hospodářských zájmů státu. Schwarzenberg podporuje bankovní unii, která znamená, že EU a zahraniční matky vysají peníze českých střadatelů do zahraničí,“ varuje Fajmon….
    http://www.parlamentnilisty.cz/rss/zpravy/Klaus-se-zle-vyjadril-o-ODS-a-zastal-se-sveho-syna-260301

  640. Dobré ráno.
    Rputi, je asi dobře, že se politici snaží být lidoví. Ale měli by být rozumní a čitelní. A neurážet zbytečně protivníka.
    Kde se učili řemeslo?

  641. nickname, souhlas.
    Leč …. stejně jako my jsou součástí této společnosti.
    Máte pocit, že tu vládne tolerance k odlišným názorům a nepadají zcela zbytečné urážky? Proč by ti politici měli být jiní?

  642. 761 Co si ve fabrice může dovolit dělník, si nesmí dovolit mistr. V dobré fabrice.
    Ještěže na facebooku nemám mnoho přátel, ti by mě zastřelili 🙂
    Dělám diverzi v čistě pro-KS vodách.

    Jestli máte kontakt na Miloše, nebo na Václava, tak prosím ať se klidní. Jinak Miloš nemůže vyhrát.

    Leoš Tržil navrhuje vykácet stromy podél silnic. Zakázat řidičům jezdit po silničních komunikacích. 🙂

  643. nickname, taky by se měly zbourat všechny domy kolem silnic – zdi jsou strašně nebezpečný 🙂

  644. http://neviditelnypes.lidovky.cz/politika-navrat-tunelare-jedi-dko-/p_politika.asp?c=A130119_105502_p_politika_wag

    Koukám, tady se také objevil hnusný a odporný pomlouvač ctihodného knížepána.

    Pepoši, nevšiml jsem si, že by tě někdo kádroval. Pouze se tu objevily názory s tvými nekorespondující. Ale tak to má snad být, ne? Nikdo ti nebrání je hájit do roztrhání těla(tedy doufám tvého). Ale pak se nediv, že ti někdo oklikou řekne, že jsi alternativní. Ale i to se dá vydržet. Stačí změnit téma. Na druhou stranu víte, jaká by tu byla hrůza, kdybychom všichni souzněli?

  645. (717) Na tom, že Zeman je pro mne absolutně nevolitelný, nemůže Klaus změnit lautr nic.

  646. 766 Bude-li každý z nás z křemene, pak celý národ z kvádrů. Nebudeme se muset zabývat vyhledáváním kádrů.

  647. (729) Ve vesnici většinově cikánské není řešením jakýkoliv běžný způsob či nezpůsob volby.
    Ledaže by zafungovalo, že ten nepřímý je pro cikány příliš složitý na přdstavivost, ale moc na to nevěřím.

  648. (737)“ Československo odsun nezpůsobilo a nemá za něj odpovědnost.“
    To bych se dost divil, že by to ti Spojenci vymysleli sami, když tím byl Beneš celou válku dost posedlý a pilně na tom pracoval.
    Bez souhlasu Spojenců to nešlo, to ano.
    Odpovědnost, jde o to jakou. Právní možná ne. Dle mého ovšem suveréní stát má vždy zodpovědnost za to, co se na jeho území a s jeho obyvateli děje. S tou suverenitou to bylo vachrlaté, ale moc ji naše vláda neprosazovala.

  649. (755)„Transakce je navíc učiněna jaksi dobrovolně.“
    Nemám dojem, že by přeslavná EU podporovala zrovna tuhle stránku ekonomiky.

  650. Ahoj! No to Fajmon nedotáhl do konce( já to teda celé nečetl)- ještě měl dodat jména.
    Živě vidím, jak KS jmenuje do čela banovní rady ČNB to nejlepší, co v současné době máme: Sedláčka!

    a jsme v hajzlu….

  651. (758) No jo, ale co Zeman? Jeho kamoši také nic moc.

  652. Ajrovko, sem už psala – jsem na tom jak ten Macek – jednoho volit nechci, druhého nemohu. Stejně dobře se mě můžeš ptát, jestli se zítra oběsím nebo skočím z mostu – já ti fakt nevím … 🙂

  653. Pohraničník – politruk Václav Sloup z KSČ, nyní radní za školství, se nemá za co stydět.

  654. Šumaváku, v hajzlu jsme v každém případě, ale je to jako volit mezi latrínou a splachovacím…

  655. Dobré ráno,

    tak se nám po ránu ucpala Malá Strana. No, aspoň jsem měla více zdravého pohybu.

    Niko,

    myslím, že mladej Klaus ustřelil. Nechal se vyprovokovat a mohl si spočítat, že jeho odpověď bude pro Mafru sousto. Poslat do kélu je mohl i bez toho, aby tam tahal volby.

    Niméně to nic nemění na tom, že Klaus poslal obchodní dopis, který nebyl určen ke zveřejnění a byla to MAfra, kdo z toho udělal zveřejněním odmítnutí politického významu.

    Myslím, že řada lidí volí knížete ne pro knížete, ale z nenávisti vůči Klausovi. Všichni pod tím Klausem tak strašně trpíííí a až nebude na hradě, nepochybně se jim uleví.

  656. A zrovna mi dorazil od spolužačky mail, že dcera povila vnuka.

    život jde svým tempem a kašle na volby 🙂

    A co u Vás, nickname?

  657. zdravím ! Pořád tady omílám dokola, že historie se opakuje, ale má ty nejpitomější žáky 🙁 Tak tedy znovu k odsunu Němců a té trapné poznámce KS ( nikoliv Jeho Jasnosti, abych nerozčílila Andy :-?): kdyby KS znal historii, tak by k Benešovi přiřadil knížete Spytihněva, který r.1055 provedl odsun Němců z českých zemí naprosto „dočista“ ( „…On si hned prvního dne,kdsy byl nastolen, velikou, podivuhodnou a po všechny věky pamětihodnou zjednal památku,neboť kolikkoli bylo nalezeno z rodu německého,ať bohatých nebo chudých nebo poutníků,kázal najednou do tří dnů vyhostiti ze země české; ba ani své matce … dceři Otově, nedovolil tu zůstati“ (Kronika Kosmova XIV). Pochybuji, že si k tomu vyžádal souhlas „mocnosti“ , že přihlédl k remcání všeholidu anebo že nějaké dodatečně odškodnil ( restituoval ) 😕
    V té době ovšem byla výhoda, že převážná většina lidu neuměla číst a že neexistovala masmédia 🙂
    Není ovšem nutno ani sahat tak daleko do historie: jednak pod pojmem „odsun“ je těm současným zapomětlivým a pitomcům sugerováno, že stejně jako v r.1055 byli i v r.1945 odsunuti všichni Němci; tak to, tedy, panstvo, nikoliv ! 😕 Zůstalo tady v Sudetech hafo německých rodin, a z těch ti Němci a Maďaři, kteří byli v r.1945 vyvlastněni na základě BD ,a podařilo se jim do r.1953 získat čsl.občanství , byli v posametové euforii odškodněni ( zákon ČNR 243/1992 Sb.,který de facto prolomil BD ):-?

  658. Já mám dovolenou, žehlím, v nemocnici je zákaz návštěv, tak na sálu asi nebudu moci být.
    Ještě není první doba. Možná to jsou poslíčci, uvidíme.

  659. (781) tedy přesněji „prolomil hranici r.1948“

  660. Tož ať už se to ptactvo neulejvá, nickname. 🙂
    Moje obě děti se narodily pár dní před termínem a rozhodně jsem si nestěžovala, že mi to očekávání bylo zkráceno.

    Víte, jetsli přiletí čáp nebo vrána?

  661. Jedna vrána tady poletuje. 🙂 Včera jsme ještě byli na procházce, možná jsme to urychlili.

  662. nickname, poslíčci jsou cca 3 týdny před porodem.

  663. 786 Uvidíme, už jsme po termínu, když by malá nechtěla ven do týdne, tak by vyvolali porod. Nejsou to kontrakce, nejsou to poslíčci, co to je?

  664. a ještě jedno doplnění k té „sudetské otázce“ : při „prolézání“ archivů jsem na vlastní oči viděla a četla říšský zákon z r.1939, podepsaný Hitlerem, kterým obyvatelům Sudet bylo umožněno optovat buď k české nebo německé národnosti – co znamenala jejich volba, nechávám vaší představitosti 😕

  665. zase čtu špatně – pepa včera napsal – 616 – že Dana a tučňák měli ve svých připomínkách pravdu a proto toho už nechá, asi tím myslel psaní komentářů. Protože se válí v posteli, tak to nevydržel a přiznal se k tomu, že porušil slib.

    Co jste si z těchto jednoduchých vět dokázali vydedukovat, to přesahuje obzory mojí jednoduché palice.

    Celou noc drobně, ale vytrvale sněžilo a včerejší ledovka se pokryla vrstvičkou sněhu. Ideální podklad pro školu smyků – jen se to moc nehodí na silnici. Chudáci sanitkáři a hasiči – jezdí skoro pořád ve dvojicích. Sanitkáři obvazují a hasiči tahají vozidla z příkopů. Bohužel jsem musel na silnici taky.

  666. ad 788 – No a jedni z nich k tomu vykřikovali:“Heim ins Reich!“ a když jim bylo vyhověno, byli zase nespokojeni.
    A slyšeli jste třeba někdy o odsunu Němců z Dánska? Nějaké požadavky na vracení majetku, stesk po domově? Právo na sebeurčení ? Ne? Čím to asi bylo…
    A ještě poměrně do nedávna – upřímně teď nevím, zd a se díky EU podmínky nezměnily – tam měli Němci úplný zákaz nakupovat nemovitosti.
    A možná se po tom odsunu o to ani moc nesnažili.

  667. AK – ad 771 – Ten Beneš musel být opravdu vtělený ďábel, když zařídil odsun Němců i z Polska, Norska , Dánska, Francie, Holandska… stačilo mu mrknout levým víčkem a spojenci skákali jak pískal.
    Neuvěřitelné!
    😉

  668. . . . me se libi jak dneska vsichni vedi, ze kdyz nemci ze sudet kriceli „Heim ins Reich“ , tak to mysleli naprosto vazne ,a byle jim treba vyhovet, kdezto kdyz jsme my cesi kriceli napriklad na Prvnino maje „Se SSSR na vecne casy“ tak to bylo pouze „jako“. . . 😉

  669. Šumaváku, zvláštní, že tehdejší představitele Polska, Dánska, atd. nikdo do Haagu hnát nechce ….. ba ani o tom nemluví …. 🙂

  670. Beneš byl skromnej chlapec, když byl za vá lky u stalina, tak mu tent o položil na stůl mapu střední Evropy a tužku, ať si nakreslí kolik chce ubrat z Německa, aby se Československo líp bránilo.
    A Beneš nechtěl…

  671. brouku, vážnost těch výkřiků byla sem tam podtržena nějakou tou českou mrtvolkou …
    To se na 1.máje teda fakt nedělo! 🙂

  672. 794-myslím, že v Polsku platí výrok opakovaný všemi představiteli, že jakýkoliv pokus o revizi výsledků 2. světové války bude znamenat novou válku ?

  673. 793 brouku, vy jste křičel? 😉
    Nevím jestli si pamatujete, jak paní Pezoldová vysoudila rodinnou hrobku (u Třeboně? u Světa?). Jednou z podmínek adopce (resp. dědictví) mělo být, že se pan Karel S. zasadí o to, aby rodu byly vráceny majetky hlubocké větve. O to se prý nezasadil, a tak by paní Pezoldová měla mít nárok na vrácení dědictví. Co se stane, až pan Schw. bude prezidentem? Bude usilovat o zrušení/obejití Lex Schw.?
    Jen tak přemýšlím, co bude panu KS bližší? Dědictví nebo ústavní pořádek?
    Asi to pošlu jako téma panu AB Bartošovi 🙂

  674. 795 Zdá se, že Beneš i Kléma znali Stalina moc dobře. A snažili se zalíbit. Věděli, co se stalo Tuchačevskému. A Sikorskému.

  675. 798- Asi to pošlu jako téma panu AB Bartošovi“

    To je dobrý nápad, alespoň nebude mít čas na psaní těch svých antisemitských sraček.

  676. Brouku, křičelo jich to tolik a mysleli to natolik vážně, že kvůli tomu vznikla Mnichovská dohoda a protektorát.

    Nickname – ona spor o hrobku prohrála, obrátila se na Ústavní soud a ten ji znovu vrátil do hry, takže myslím, že to zatím není ukončené.

  677. 800 a MZ to použije v debatě proti KS. Co jsou to za klauni?
    Tudle jsem přišel na úřad a úředník se ptal, nejsou oni samý židi? Říkám, ne, evangelíci. Tak to já jsem zase papeženec. A pak že mocnářství nežije. 🙂

    801 bingo 😉 Kdo jmenuje soudce? Divím se, že o privatizaci Becherovky zatím metači mlčí.
    Asi se vyčerpali dekretama.

  678. no tedy, nevratit hrobku je opravdu mistrne dilo. jeste ze nebylo naledi. je mi z toho cteni trochu smutno.

  679. copak u nás, nacisti a vydřiduši, tlučhubové a opilci na prezidenta! Taková Británie má následníka vraha! Princ Harry se přiznal, že zabíjel talibance. Je vidět, že nebyl na výcviku u nás nebo v Rusku. Stačilo by kouknout a hned by věděl, jestli je ten chlap naproti s kalašnikovem hodný talibanec nebo zlý teroristický talibanec. A představte si! Před novináři to klidně přiznal a ani se neomluvil za veškerá staletá příkoří lstivým Afgáncům.

    A Berdyč už je zase nejhorší na světě – dovolil si prohrávat se světovou jedničkou 2:1.

  680. ( 800) „antisemitské sračky“ 🙂 Milá Andy, nějak byste si to svoje “ podvědomí“ (vůbec se neodvažuji napsat slovo „nevědomí“) nějak umravnit, aby bylo trochu konzistentní 😕 Věřím ve Vaší inteligenci,jistě chápete, co tím na mysli ,a tak nad tímto mým doporučením nemusíte dělat otazník 😕

  681. 804 Jirko, zatím není vrácená. Ale ani nevrácená. Jsou to soudy mezi šlechtici a purkrabími. Feudalismu nerozumím.

  682. nickname, ubohost je muset se soudit o hrobku. Ještě v tom lítají památkáři – k posrání. Co kdyby ten hnusný vlastník hrobky z ní chtěl udělat bordel? Jak by si to pilná a odpovědná páteř zodpověděla vůči všeholidu. Jirkovi je smutno, já se obvykle naseru, i když to není moje hrobka. Znám bohužel české zákony o pohřebnictví a mám za sebou, jak jsem tu již psal, boje s pražskou pohřebnickou páteří v motolském urnovém háji.

  683. No s tím SS (sovětským svazem) jsem to myslel doopravdy !
    Ale voní mi ho nějank zrušili….
    Tak snad ta EUrořiše dopadne podobně; velebte ji prosím stejně hlasitě …

  684. 808 Je to ubohost, souhlasím. Proč jim to za 1000Kč neprodají a je klid a nemusí se soudit na tři doby? Nechápu. Chce paní Pezoldová tímto precedentem něčeho dosáhnout? Nevím.
    U nás je z kapucínského kláštera byťák. Z kostela koncertní místo, aspoň to. Nostická hrobka byla vykradená, zdevastovaná. Teď je alespoň pietněji ošetřeno.
    Židovský hřbitov? Místo feťáků. Místo po koncentráku? Na jednom místě sídliště. Druhý koncentrák? Podnikatelské baroko hned naproti památníku.

  685. Nejsem si úplně jist, protože mám jiné starosti…,ale zatím mám za to že stav je takový, že hrobka patří Karlovi S. a Petzoldová se soudí s ním.
    A jestli bude Schw. hrobka patřit KS nebo Petzoldové je mi tak nějak srdečně jedno…

  686. no, vite, hroby snad by meli byt tak nejak nedotknutelne za jakehokoliv rezimu a stavu. ale nechci se v tom babrat, v podstate je to marginalie, vzdyt to neni dulezite…. nepresta mne zarazet to, ze v podstate neni zadna jistota i po smrti. tedy pokud to tak mohu rici a doufam ze mi nekdo porozumi. chybi. ta pieta, to se dneska nenosi. vzdyt je docela zajimave si jit „vypit kafe s prapradedeckem“ tedy alespo pro mne.

  687. 812 Je fajn, když někde v bažinách najdete památku na hřbitov. Ale to je jiný kraj, jiná vesnice.
    Docela pěkně to prý prožívají v Argentině. Tam mívají rodinné pikniky na hřbitově.

    Kdybyste někdo hledal profesionálního hrobníka, ozvěte se. Přestavil si opuštěnou hrobku na barák. Rozházené ostatky samozřejmě pietně pohřbil.

  688. 806- ne, nechápu, co máte na mysli. Jestli to, že vám Bartošovy plky konvenují a tudíž docházíte k názoru, že já na věc nahlížím špatně, pak je to spíš váš problém a své amatérské psychologické úvahy nemusíte adresovat mně.

  689. Ach jo…

    naše pracovní mládež blbne a hodlá vyvěsit v kanclu do okna plakát se Schwanzerbergem…

    Abych ještě nedopadla jako Dejdar, i když teda Zemana rozhodně volit nehodlám.

  690. (816) já především “ Bartošovy plky“ nečtu, takže mne neoslovují ani kladně ani záporně 😕 O mých znalostech psychologie víte tak málo jako já o Vašich -tak si ,prosím, to Vaše hodnocení mých „psychologických znalostí „nechte pro sebe stejně jako já si nechávám pro sebe hodnocení Vašich „psychologických znalostí“ -zrovna Vás bych si pro syna jako psychologa zcela určitě nevybrala 😕

  691. Ještě něco o pánu hráběti aneb není tam jen Bartoš: http://neviditelnypes.lidovky.cz/politika-navrat-tunelare-jedi-dko-/p_politika.asp?c=A130119_105502_p_politika_wag

    Ale ještě něco pro uklidnění z poddiskuse u Kocoura:

    Žabí karbanátky:
    Vezmi velké pěkné žáby, pazourky uřež, kůstky jim vyndej, naklep je jako karbanátle, posol je, nech as čtvrt hodiny ležeti, osuš šatem, namoč je do omastku, posyp drobnou žemličkou, rozpal na rendlíku omastek, vlož tam karbanátky, vypeč hodně po obou stranách, vyklop je na mísu s máslem, s citronovou šťávou a zelenou petruželí.

  692. Maydo, gratuluji a Nickname přeji hodně sil při čekání. Jak vidno nedopadnem jako jetti od mých oblíbených klasiků, který:….uchvátil bioložku Ekrtovou a s výkřikem:“Přeci nevyhynu!“ zmizel v ledových dálavách.

  693. Tak mne nějak napadlo, jak by vypadalo provozování sračkometů v případě volby presidenta parlamentem. Třeba kdyby se finalistami stali Dienstbier a Schwarzenberg. Ale nic nového pod sluncem. To co se dělo okolo presidentských voleb 1935 také nevypovídá o politické (a pochopitelně novinářské) kultuře.

  694. Dano, oni jsou jak malí… když chtějí společenské centrum, mají od Kaplického k dispozici budějckého rejnoka… 🙂
    No ale zase… to by nikdo nedostal od radnice zaplaceno za (zásadní) změnu projektu, že?

  695. A jinak k diskusím o KS: většina diskutujících – jsouc nepoučena z historie – netuší o existenci dvou větví rodu (Hluboká a Orlík), takže mnohé závěry jsou debilní až běda.
    A abych také uplivnul jedovatou slinu: jak to, že se nikdo nezajímá, co byl za člověka Zemanův tchán. A jelikož měl ty tchány dva, tak je větši pravděpodobnost, že by se tam něco našlo.

  696. Františku, děkuji. Moje chuděra je tam sama 🙁
    822 To bylo proti Milošovi nebo proti Karlovi? Abych věděl, jaký si udělat názor:-)

  697. 821- když je nečtete, tak proč ten váš komentář? Banik banik?

  698. ….my nesmíme ani naznačovat..ale bylo to proti amnestii. Jinak žáby jsou apolitické(alespoň doufám).

    Chtěl jsem si počíst něco nepolitického, takže jsem se vydal do vědy. A hle, malachitová plíseň, pardon zeleň od zlovolného tuším Drábka

    …Před firmou Karla Schwarzenberga tak stála vidina ztráty v řádu milionů korun. Dohodl se proto s šéfem svého rybářského hospodářství Václavem Čížkem na tom, jak nepříjemný zákaz obejít. Václav Čížek založil společnost s ručením omezeným Leryz se sídlem ve Žďáru nad Sázavou, odkud pocházel. Firma Leryz měla chov ryb jako předmět podnikání a označila se jako původní vlastník ryb při prodeji produkce ze schwarzenberských rybníků. Ryby koupené od Karla Schwarzenberga firma Leryz prodala dalším obchodníkům s rybami se zahraniční účastí. Pro ty pak při vývozu už nebyly místem původu rybníky Karla Schwarzenberga. V podstatě už nikdo nezkoumal, ze kterých rybníků ryby pocházejí a spotřebitelé v zemích Evropské unie je spokojeně zkonzumovali.

    Dobrou chuť, děti..

  699. DVD: Kádrový posudek: Jeden tchán byl politický vězeň, druhý nedohledán. Rozvedli se už v roce 1978.

  700. 830-ale no tak, tento aristokrat přece nepotřebuje podvádět a krást, to je jeho hlavní deviza. A i kdyby, je tak rozkošný, milučký, s motýlkem…

  701. Pojďte do horní hospody na pivo, mám americké…

  702. (792) Ten odsun od nás skutečně domluvil, ty ostatní asi tamní Benešové.
    Skákat nemuseli, hlavně že nám je nevraceli.
    Mimochodem, s tou vděčností za odsunutí mimo dosah socialismu, to mne také napadlo. A sudeťáky, tak někdy v padesátých nejspíš také. Ovšem s vyjímkou těch, kteří byli odšoupnuti do DeDeRonu.
    😛

  703. (794) Sleduješ tamní dění tak podrobně, abys to mohla s jistotou tvrdit? Ani zde nechce, jen to občas někdo rozviřuje (zde naposledy Zeman), neb se mu to hodí do krámu. Jestli máš v dosahu dnešní Lidovky, je tam pěkný článek „Dekrety pohledem Sudeťáka“. Doporučuji.

  704. DVD – já vím že dvě větve.Ale mám zafixováno, že někdy kolem 1965 +/-něco rakoské soudy rozhodly, že dědicem (podle závěti) bude Karel a Petzoldová utře.
    Takže si myslím, že jí jde o prolomení tohoto rozhodnutí a KS o prolomení Lex Schwarzenberg.

    Ale mohu se samozřejmě mýlit, protože to fakt sleduji jedním uchem dovnitř, druhým ven.A sem tam něco někde ulpí…

  705. 720 Jaka, pochop, že to je jiná rozpočtová kapoitola. V ní ušetřil. Jiné ho nezajímají. Tkhle to funguje obecně.

  706. 822 Františku, to by musely být velké jako kuře aby to stálo za vykošťování. Než bych se s tím vybabral dozajista by mě hlad přešel, protože bych se nadlábnul něčím jiným. ne, že bych nerad stehýnka. Ale je to hladové jídlo. Tedy tak jak se běžně servíruje. K najedení bych jich musel mít mísu. A dostat ji rovnou pod nos. Ale představa, že se babrám se škopkem žab…

Komentáře nejsou povoleny.